EMAIL THIS PAGE TO A FRIEND

TBC1D8B

TBC1 domain family, member 8B (with GRAM domain)

UniProtKB ID: Q0IIM8, B9A6K5, B9A6K6, Q5JRB7, Q6ZVX5, Q9NXE3
Gene ID:
Human(54885) Summary: This gene encodes a protein with a TBC (Tre-2/Bub2/CDC16) domain. Some mammalian proteins with this domain have been shown to function as Rab-GAPs by binding to specific Rab proteins and affecting their GTPase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Mouse(245638) TBC1 domain family, member 8B
domestic guinea pig(100720697) TBC1 domain family, member 8B (with GRAM domain)
naked mole-rat(101698178) TBC1 domain family, member 8B (with GRAM domain)
Domestic Rabbit(100349864) TBC1 domain family, member 8B (with GRAM domain)
cow(100337282) TBC1 domain family, member 8B (with GRAM domain)
sheep(101116384) TBC1 domain family, member 8B (with GRAM domain)
chicken(422383) TBC1 domain family, member 8B (with GRAM domain)
Horse(100060869) TBC1 domain family, member 8B (with GRAM domain)
domestic cat(101084266) TBC1 domain family, member 8B (with GRAM domain)
dog(492052) TBC1 domain family, member 8B (with GRAM domain)
180 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017752 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017752 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017752 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081499 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081499 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081499 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017752 Rosetta Predictions human pricing
NM_198881 Rosetta Predictions human pricing
NM_001081499 Rosetta Predictions mouse pricing
XM_621096 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245522 predicted 642
2 SASI_Hs01_00245523 predicted 1574
3 SASI_Hs01_00245524 predicted 1369
4 SASI_Hs02_00350564 predicted 627
5 SASI_Hs01_00245525 predicted 1085
6 SASI_Hs01_00245528 predicted 1555
7 SASI_Hs02_00350565 predicted 754
8 SASI_Hs01_00245529 predicted 619
9 SASI_Hs02_00350566 predicted 375
10 SASI_Hs01_00245530 predicted 1285
11 SASI_Hs01_00245526 predicted 313
12 SASI_Hs01_00245527 predicted 946
13 SASI_Hs01_00245531 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042062 predicted 639
2 SASI_Hs01_00042063 predicted 1569
3 SASI_Hs01_00042064 predicted 1364
4 SASI_Hs02_00372383 predicted 628
5 SASI_Hs01_00042065 predicted 1080
6 SASI_Hs01_00042068 predicted 1558
7 SASI_Hs02_00372384 predicted 757
8 SASI_Hs01_00042069 predicted 621
9 SASI_Hs02_00372385 predicted 382
10 SASI_Hs01_00042070 predicted 1289
11 SASI_Hs01_00042066 predicted 308
12 SASI_Hs01_00042067 predicted 952
13 SASI_Hs01_00042071 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298640 predicted 2909
2 SASI_Mm02_00298641 predicted 1710
3 SASI_Mm02_00298642 predicted 342
4 SASI_Mm02_00298643 predicted 3567
5 SASI_Mm02_00298644 predicted 304
6 SASI_Mm02_00298645 predicted 1820
7 SASI_Mm02_00298646 predicted 2891
8 SASI_Mm02_00298647 predicted 1593
9 SASI_Mm02_00298648 predicted 346
10 SASI_Mm02_00298649 predicted 1579
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_621096 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254797 predicted 2921
2 SASI_Mm01_00254798 predicted 3144
3 SASI_Mm01_00254799 predicted 2293
4 SASI_Mm01_00254800 predicted 1720
5 SASI_Mm01_00254801 predicted 3569
6 SASI_Mm01_00254802 predicted 1818
7 SASI_Mm01_00254803 predicted 2897
8 SASI_Mm01_00254804 predicted 1595
9 SASI_Mm01_00254805 predicted 2168
10 SASI_Mm01_00254806 predicted 2707
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017752
TBC1D8B MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 8B (with GRAM domain)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017752.2-1229s1c1
Sequence:CCGGCCAGCAAATCTGTCATCATTACTCGAGTAATGATGACAGATTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017752.2-645s1c1
Sequence:CCGGGACCTATTATTCATGCAGTTACTCGAGTAACTGCATGAATAATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017752.2-2458s1c1
Sequence:CCGGCGCTGTCGAAATAGGTTGTATCTCGAGATACAACCTATTTCGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017752.2-2369s1c1
Sequence:CCGGCCAGTCATACTAGAGTGGATACTCGAGTATCCACTCTAGTATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017752.2-1361s1c1
Sequence:CCGGGCACAGAGCTTGCTATTAGTTCTCGAGAACTAATAGCAAGCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017752.2-1689s21c1
Sequence:CCGGTACTAATCCTGACTATTATACCTCGAGGTATAATAGTCAGGATTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017752.2-3966s21c1
Sequence:CCGGTATGTCATGTCAATCGATAAACTCGAGTTTATCGATTGACATGACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017752
TBC1D8B MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 8B (with GRAM domain)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017752.2-1229s1c1
Sequence:CCGGCCAGCAAATCTGTCATCATTACTCGAGTAATGATGACAGATTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017752.2-645s1c1
Sequence:CCGGGACCTATTATTCATGCAGTTACTCGAGTAACTGCATGAATAATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017752.2-2458s1c1
Sequence:CCGGCGCTGTCGAAATAGGTTGTATCTCGAGATACAACCTATTTCGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017752.2-2369s1c1
Sequence:CCGGCCAGTCATACTAGAGTGGATACTCGAGTATCCACTCTAGTATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017752.2-1361s1c1
Sequence:CCGGGCACAGAGCTTGCTATTAGTTCTCGAGAACTAATAGCAAGCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017752.2-1689s21c1
Sequence:CCGGTACTAATCCTGACTATTATACCTCGAGGTATAATAGTCAGGATTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017752.2-3966s21c1
Sequence:CCGGTATGTCATGTCAATCGATAAACTCGAGTTTATCGATTGACATGACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017752
TBC1D8B MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 8B (with GRAM domain)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017752.2-1229s1c1
Sequence:CCGGCCAGCAAATCTGTCATCATTACTCGAGTAATGATGACAGATTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017752.2-645s1c1
Sequence:CCGGGACCTATTATTCATGCAGTTACTCGAGTAACTGCATGAATAATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017752.2-2458s1c1
Sequence:CCGGCGCTGTCGAAATAGGTTGTATCTCGAGATACAACCTATTTCGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017752.2-2369s1c1
Sequence:CCGGCCAGTCATACTAGAGTGGATACTCGAGTATCCACTCTAGTATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017752.2-1361s1c1
Sequence:CCGGGCACAGAGCTTGCTATTAGTTCTCGAGAACTAATAGCAAGCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017752.2-1689s21c1
Sequence:CCGGTACTAATCCTGACTATTATACCTCGAGGTATAATAGTCAGGATTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017752.2-3966s21c1
Sequence:CCGGTATGTCATGTCAATCGATAAACTCGAGTTTATCGATTGACATGACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081499
VALIDATED
TBC1D8B MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 8B (with GRAM domain)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081499.2-2390s21c1
Sequence:CCGGTCATACTAAAGTGGATATTACCTCGAGGTAATATCCACTTTAGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081499.2-857s21c1
Sequence:CCGGTCAAGGAGAGAATCACTATTTCTCGAGAAATAGTGATTCTCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081499.2-2467s21c1
Sequence:CCGGATAGCATGCGCTGTCGAAATACTCGAGTATTTCGACAGCGCATGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081499.2-4472s21c1
Sequence:CCGGTACTTACTAGGGTACTATATACTCGAGTATATAGTACCCTAGTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081499.2-2282s21c1
Sequence:CCGGTGAAGCGGTGACGGCACTAAACTCGAGTTTAGTGCCGTCACCGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081499
VALIDATED
TBC1D8B MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 8B (with GRAM domain)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081499.2-2390s21c1
Sequence:CCGGTCATACTAAAGTGGATATTACCTCGAGGTAATATCCACTTTAGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081499.2-857s21c1
Sequence:CCGGTCAAGGAGAGAATCACTATTTCTCGAGAAATAGTGATTCTCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081499.2-2467s21c1
Sequence:CCGGATAGCATGCGCTGTCGAAATACTCGAGTATTTCGACAGCGCATGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081499.2-4472s21c1
Sequence:CCGGTACTTACTAGGGTACTATATACTCGAGTATATAGTACCCTAGTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081499.2-2282s21c1
Sequence:CCGGTGAAGCGGTGACGGCACTAAACTCGAGTTTAGTGCCGTCACCGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081499
VALIDATED
TBC1D8B MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 8B (with GRAM domain)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081499.2-2390s21c1
Sequence:CCGGTCATACTAAAGTGGATATTACCTCGAGGTAATATCCACTTTAGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081499.2-857s21c1
Sequence:CCGGTCAAGGAGAGAATCACTATTTCTCGAGAAATAGTGATTCTCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081499.2-2467s21c1
Sequence:CCGGATAGCATGCGCTGTCGAAATACTCGAGTATTTCGACAGCGCATGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081499.2-4472s21c1
Sequence:CCGGTACTTACTAGGGTACTATATACTCGAGTATATAGTACCCTAGTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081499.2-2282s21c1
Sequence:CCGGTGAAGCGGTGACGGCACTAAACTCGAGTTTAGTGCCGTCACCGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks