EMAIL THIS PAGE TO A FRIEND

TBC1D9

TBC1 domain family, member 9 (with GRAM domain)

Synonyms: MDR1
UniProtKB ID: Q6ZT07, A6H8U8, D3DNZ1, O94958
Gene ID:
Mouse(71310) TBC1 domain family, member 9
Rat(304645) TBC1 domain family, member 9 (with GRAM domain)
Zebrafish(563578) TBC1 domain family, member 9 (with GRAM domain)
Horse(100071321) TBC1 domain family, member 9 (with GRAM domain)
domestic cat(101097890) TBC1 domain family, member 9 (with GRAM domain)
dog(476074) TBC1 domain family, member 9 (with GRAM domain)
chicken(422452) TBC1 domain family, member 9 (with GRAM domain)
cow(537817) TBC1 domain family, member 9 (with GRAM domain)
sheep(101104859) TBC1 domain family, member 9 (with GRAM domain)
naked mole-rat(101715569) TBC1 domain family, member 9 (with GRAM domain)
domestic guinea pig(100736144) TBC1 domain family, member 9 (with GRAM domain)
126 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015130 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015130 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015130 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_093895 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_093895 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_093895 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027758 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027758 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027758 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026851 MISSION® esiRNA esiRNA human TBC1D9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015130 Rosetta Predictions human pricing
NM_001134539 Rosetta Predictions rat pricing
NM_001111304 Rosetta Predictions mouse pricing
NM_027758 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015130 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211146 predicted 1030
2 SASI_Hs01_00211147 predicted 1498
3 SASI_Hs02_00347042 predicted 1247
4 SASI_Hs01_00211149 predicted 1746
5 SASI_Hs01_00211150 predicted 2044
6 SASI_Hs02_00347043 predicted 448
7 SASI_Hs01_00211151 predicted 3092
8 SASI_Hs01_00211152 predicted 2566
9 SASI_Hs01_00211153 predicted 3351
10 SASI_Hs02_00347044 predicted 3581
11 SASI_Hs01_00211148 predicted 804
12 SASI_Hs01_00211154 predicted 1013
13 SASI_Hs01_00211155 predicted 2300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134539 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256879 predicted 2507
2 SASI_Rn02_00256880 predicted 1676
3 SASI_Rn02_00256881 predicted 2819
4 SASI_Rn02_00256882 predicted 2423
5 SASI_Rn02_00256883 predicted 3055
6 SASI_Rn02_00256884 predicted 1268
7 SASI_Rn02_00256885 predicted 4025
8 SASI_Rn02_00256886 predicted 2490
9 SASI_Rn02_00256887 predicted 919
10 SASI_Rn02_00256888 predicted 3358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111304 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306745 predicted 2432
2 SASI_Mm02_00306746 predicted 2534
3 SASI_Mm02_00306747 predicted 3617
4 SASI_Mm02_00306748 predicted 3809
5 SASI_Mm02_00306749 predicted 3031
6 SASI_Mm02_00306750 predicted 3062
7 SASI_Mm02_00306751 predicted 3425
8 SASI_Mm02_00306752 predicted 3048
9 SASI_Mm02_00306753 predicted 2683
10 SASI_Mm02_00306754 predicted 3617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095041 predicted 1734
2 SASI_Mm02_00332707 predicted 1834
3 SASI_Mm01_00095042 predicted 2912
4 SASI_Mm01_00095044 predicted 3117
5 SASI_Mm01_00095045 predicted 2330
6 SASI_Mm01_00095046 predicted 2363
7 SASI_Mm01_00095047 predicted 2725
8 SASI_Mm01_00095048 predicted 2345
9 SASI_Mm01_00095049 predicted 1981
10 SASI_Mm02_00332708 predicted 2919
11 SASI_Mm01_00095040 predicted 2875
12 SASI_Mm01_00095043 predicted 1840
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015130
TBC1D9 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 9 (with GRAM domain)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000376655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015130.2-2263s21c1
Sequence:CCGGTGCAAGACCTGGGCGTGATTTCTCGAGAAATCACGCCCAGGTCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015130.2-4526s21c1
Sequence:CCGGGCATAGTCAGCGAGGGTAAATCTCGAGATTTACCCTCGCTGACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015130.2-2946s21c1
Sequence:CCGGTCCCGCTTGTTCCAGTTATTACTCGAGTAATAACTGGAACAAGCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015130.2-2299s21c1
Sequence:CCGGCTTGGTTCCTCACACTATTTCCTCGAGGAAATAGTGTGAGGAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015130
TBC1D9 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 9 (with GRAM domain)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000376655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015130.2-2263s21c1
Sequence:CCGGTGCAAGACCTGGGCGTGATTTCTCGAGAAATCACGCCCAGGTCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015130.2-4526s21c1
Sequence:CCGGGCATAGTCAGCGAGGGTAAATCTCGAGATTTACCCTCGCTGACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015130.2-2946s21c1
Sequence:CCGGTCCCGCTTGTTCCAGTTATTACTCGAGTAATAACTGGAACAAGCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015130.2-2299s21c1
Sequence:CCGGCTTGGTTCCTCACACTATTTCCTCGAGGAAATAGTGTGAGGAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015130
TBC1D9 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 9 (with GRAM domain)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000376655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015130.2-2263s21c1
Sequence:CCGGTGCAAGACCTGGGCGTGATTTCTCGAGAAATCACGCCCAGGTCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015130.2-4526s21c1
Sequence:CCGGGCATAGTCAGCGAGGGTAAATCTCGAGATTTACCCTCGCTGACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015130.2-2946s21c1
Sequence:CCGGTCCCGCTTGTTCCAGTTATTACTCGAGTAATAACTGGAACAAGCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015130.2-2299s21c1
Sequence:CCGGCTTGGTTCCTCACACTATTTCCTCGAGGAAATAGTGTGAGGAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_093895
VALIDATED
TBC1D9 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 9 (with GRAM domain)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:XM_093895.6-451s1c1
Sequence:CCGGCGCTCCTTACCGAATCTTGTACTCGAGTACAAGATTCGGTAAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:XM_093895.6-2601s1c1
Sequence:CCGGCCTACGAGAAATTCGGAACTACTCGAGTAGTTCCGAATTTCTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_093895.6-1886s1c1
Sequence:CCGGCCTGGGTACTATGAAGACCTACTCGAGTAGGTCTTCATAGTACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:XM_093895.6-1465s1c1
Sequence:CCGGCCTGCAACAGACTACTTCCAACTCGAGTTGGAAGTAGTCTGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:XM_093895.6-3323s1c1
Sequence:CCGGGCAAAGGATTTACCCAAATTACTCGAGTAATTTGGGTAAATCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_093895
VALIDATED
TBC1D9 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 9 (with GRAM domain)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:XM_093895.6-451s1c1
Sequence:CCGGCGCTCCTTACCGAATCTTGTACTCGAGTACAAGATTCGGTAAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:XM_093895.6-2601s1c1
Sequence:CCGGCCTACGAGAAATTCGGAACTACTCGAGTAGTTCCGAATTTCTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_093895.6-1886s1c1
Sequence:CCGGCCTGGGTACTATGAAGACCTACTCGAGTAGGTCTTCATAGTACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:XM_093895.6-1465s1c1
Sequence:CCGGCCTGCAACAGACTACTTCCAACTCGAGTTGGAAGTAGTCTGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:XM_093895.6-3323s1c1
Sequence:CCGGGCAAAGGATTTACCCAAATTACTCGAGTAATTTGGGTAAATCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_093895
VALIDATED
TBC1D9 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 9 (with GRAM domain)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:XM_093895.6-451s1c1
Sequence:CCGGCGCTCCTTACCGAATCTTGTACTCGAGTACAAGATTCGGTAAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:XM_093895.6-2601s1c1
Sequence:CCGGCCTACGAGAAATTCGGAACTACTCGAGTAGTTCCGAATTTCTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_093895.6-1886s1c1
Sequence:CCGGCCTGGGTACTATGAAGACCTACTCGAGTAGGTCTTCATAGTACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:XM_093895.6-1465s1c1
Sequence:CCGGCCTGCAACAGACTACTTCCAACTCGAGTTGGAAGTAGTCTGTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:XM_093895.6-3323s1c1
Sequence:CCGGGCAAAGGATTTACCCAAATTACTCGAGTAATTTGGGTAAATCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027758
TBC1D9 MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 9 (with GRAM domain)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027758.1-4239s1c1
Sequence:CCGGCGAAGTACTTTAGTGAGACTTCTCGAGAAGTCTCACTAAAGTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027758.1-1278s1c1
Sequence:CCGGGCTCAGATGATGAGGTGTATTCTCGAGAATACACCTCATCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027758.1-908s1c1
Sequence:CCGGCCGTACCGAATCCTTTATCAACTCGAGTTGATAAAGGATTCGGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027758.1-3118s1c1
Sequence:CCGGGCTCTGTAAGACCATGTACAACTCGAGTTGTACATGGTCTTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027758.1-1738s1c1
Sequence:CCGGCCCAGCTTTCCAGAACGAAATCTCGAGATTTCGTTCTGGAAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027758
TBC1D9 MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 9 (with GRAM domain)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027758.1-4239s1c1
Sequence:CCGGCGAAGTACTTTAGTGAGACTTCTCGAGAAGTCTCACTAAAGTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027758.1-1278s1c1
Sequence:CCGGGCTCAGATGATGAGGTGTATTCTCGAGAATACACCTCATCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027758.1-908s1c1
Sequence:CCGGCCGTACCGAATCCTTTATCAACTCGAGTTGATAAAGGATTCGGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027758.1-3118s1c1
Sequence:CCGGGCTCTGTAAGACCATGTACAACTCGAGTTGTACATGGTCTTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027758.1-1738s1c1
Sequence:CCGGCCCAGCTTTCCAGAACGAAATCTCGAGATTTCGTTCTGGAAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027758
TBC1D9 MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 9 (with GRAM domain)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027758.1-4239s1c1
Sequence:CCGGCGAAGTACTTTAGTGAGACTTCTCGAGAAGTCTCACTAAAGTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027758.1-1278s1c1
Sequence:CCGGGCTCAGATGATGAGGTGTATTCTCGAGAATACACCTCATCATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027758.1-908s1c1
Sequence:CCGGCCGTACCGAATCCTTTATCAACTCGAGTTGATAAAGGATTCGGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027758.1-3118s1c1
Sequence:CCGGGCTCTGTAAGACCATGTACAACTCGAGTTGTACATGGTCTTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027758.1-1738s1c1
Sequence:CCGGCCCAGCTTTCCAGAACGAAATCTCGAGATTTCGTTCTGGAAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks