EMAIL THIS PAGE TO A FRIEND

TBC1D9B

TBC1 domain family, member 9B (with GRAM domain)

Gene ID:
Mouse(76795) TBC1 domain family, member 9B
Rat(360520) TBC1 domain family, member 9B (with GRAM domain)
domestic guinea pig(100730583) TBC1 domain family, member 9B (with GRAM domain)
naked mole-rat(101726313) TBC1 domain family, member 9B (with GRAM domain)
Domestic Rabbit(100346575) TBC1 domain family, member 9B (with GRAM domain)
cow(514521) TBC1 domain family, member 9B (with GRAM domain)
sheep(101118784) TBC1 domain family, member 9B (with GRAM domain)
Zebrafish(100332046) TBC1 domain family, member 9B (with GRAM domain)
Horse(100067181) TBC1 domain family, member 9B (with GRAM domain)
domestic cat(101095463) TBC1 domain family, member 9B (with GRAM domain)
dog(481460) TBC1 domain family, member 9B (with GRAM domain)
chicken(416282) TBC1 domain family, member 9B (with GRAM domain)
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA038350 Anti-TBC1D9B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015043 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015043 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015043 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029745 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029745 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029745 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015043 Rosetta Predictions human pricing
NM_198868 Rosetta Predictions human pricing
NM_001108274 Rosetta Predictions rat pricing
NM_029745 Rosetta Predictions mouse pricing
XM_910858 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165025 predicted 2115
2 SASI_Hs01_00165026 predicted 637
3 SASI_Hs01_00165027 predicted 943
4 SASI_Hs01_00165028 predicted 349
5 SASI_Hs01_00165029 predicted 3625
6 SASI_Hs01_00165030 predicted 2467
7 SASI_Hs01_00165031 predicted 2624
8 SASI_Hs01_00165032 predicted 331
9 SASI_Hs02_00346881 predicted 2378
10 SASI_Hs02_00346882 predicted 850
11 SASI_Hs01_00165024 predicted 2505
12 SASI_Hs01_00165033 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198868 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187627 predicted 2117
2 SASI_Hs01_00187628 predicted 629
3 SASI_Hs01_00187629 predicted 942
4 SASI_Hs01_00187630 predicted 348
5 SASI_Hs01_00187631 predicted 3668
6 SASI_Hs01_00187632 predicted 2468
7 SASI_Hs01_00187633 predicted 2632
8 SASI_Hs01_00187634 predicted 329
9 SASI_Hs02_00372378 predicted 2377
10 SASI_Hs02_00372379 predicted 848
11 SASI_Hs01_00187626 predicted 2504
12 SASI_Hs01_00187635 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108274 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237044 predicted 3735
2 SASI_Rn02_00237045 predicted 1032
3 SASI_Rn02_00237046 predicted 912
4 SASI_Rn02_00237047 predicted 1894
5 SASI_Rn02_00237048 predicted 1157
6 SASI_Rn02_00237049 predicted 2533
7 SASI_Rn02_00237050 predicted 2772
8 SASI_Rn02_00237051 predicted 882
9 SASI_Rn02_00237052 predicted 3852
10 SASI_Rn02_00237053 predicted 1880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029745 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335844 predicted 1037
2 SASI_Mm02_00335845 predicted 1002
3 SASI_Mm02_00335846 predicted 1163
4 SASI_Mm02_00335847 predicted 2536
5 SASI_Mm02_00335848 predicted 3034
6 SASI_Mm02_00335849 predicted 2788
7 SASI_Mm02_00335850 predicted 891
8 SASI_Mm02_00335851 predicted 2417
9 SASI_Mm02_00335852 predicted 3159
10 SASI_Mm02_00335853 predicted 3719
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910858 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274355 predicted 1046
2 SASI_Mm01_00274356 predicted 1009
3 SASI_Mm01_00274357 predicted 1169
4 SASI_Mm01_00274358 predicted 2544
5 SASI_Mm01_00274359 predicted 404
6 SASI_Mm01_00274360 predicted 899
7 SASI_Mm01_00274361 predicted 1021
8 SASI_Mm01_00274362 predicted 3384
9 SASI_Mm01_00274363 predicted 2428
10 SASI_Mm01_00274364 predicted 3209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015043
VALIDATED
TBC1D9B MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 9B (with GRAM domain)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015043.3-1170s1c1
Sequence:CCGGCCAACCTGAAAGACCGTGATTCTCGAGAATCACGGTCTTTCAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015043.3-2456s1c1
Sequence:CCGGCGAGCTATACCTGTGGACATTCTCGAGAATGTCCACAGGTATAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015043.3-370s1c1
Sequence:CCGGCAAGGGCAAGATACACGGAATCTCGAGATTCCGTGTATCTTGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015043.3-2216s1c1
Sequence:CCGGCTGGGCAGATACCTGGATAATCTCGAGATTATCCAGGTATCTGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015043.3-2335s1c1
Sequence:CCGGCCTGAAAGTGTCCTATGAGAACTCGAGTTCTCATAGGACACTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015043.3-3070s21c1
Sequence:CCGGTGAGCTGTGCAAGACGCTTTACTCGAGTAAAGCGTCTTGCACAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015043.3-1170s21c1
Sequence:CCGGCCAACCTGAAAGACCGTGATTCTCGAGAATCACGGTCTTTCAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015043.3-370s21c1
Sequence:CCGGCAAGGGCAAGATACACGGAATCTCGAGATTCCGTGTATCTTGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015043.3-2456s21c1
Sequence:CCGGCGAGCTATACCTGTGGACATTCTCGAGAATGTCCACAGGTATAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015043.3-4012s21c1
Sequence:CCGGAGCTGCACCTGCCTAGCATTACTCGAGTAATGCTAGGCAGGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015043.3-2381s21c1
Sequence:CCGGATTGAGCAGATGCGGTTTAAACTCGAGTTTAAACCGCATCTGCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015043
VALIDATED
TBC1D9B MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 9B (with GRAM domain)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015043.3-1170s1c1
Sequence:CCGGCCAACCTGAAAGACCGTGATTCTCGAGAATCACGGTCTTTCAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015043.3-2456s1c1
Sequence:CCGGCGAGCTATACCTGTGGACATTCTCGAGAATGTCCACAGGTATAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015043.3-370s1c1
Sequence:CCGGCAAGGGCAAGATACACGGAATCTCGAGATTCCGTGTATCTTGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015043.3-2216s1c1
Sequence:CCGGCTGGGCAGATACCTGGATAATCTCGAGATTATCCAGGTATCTGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015043.3-2335s1c1
Sequence:CCGGCCTGAAAGTGTCCTATGAGAACTCGAGTTCTCATAGGACACTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015043.3-3070s21c1
Sequence:CCGGTGAGCTGTGCAAGACGCTTTACTCGAGTAAAGCGTCTTGCACAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015043.3-1170s21c1
Sequence:CCGGCCAACCTGAAAGACCGTGATTCTCGAGAATCACGGTCTTTCAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015043.3-370s21c1
Sequence:CCGGCAAGGGCAAGATACACGGAATCTCGAGATTCCGTGTATCTTGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015043.3-2456s21c1
Sequence:CCGGCGAGCTATACCTGTGGACATTCTCGAGAATGTCCACAGGTATAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015043.3-4012s21c1
Sequence:CCGGAGCTGCACCTGCCTAGCATTACTCGAGTAATGCTAGGCAGGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015043.3-2381s21c1
Sequence:CCGGATTGAGCAGATGCGGTTTAAACTCGAGTTTAAACCGCATCTGCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015043
VALIDATED
TBC1D9B MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 9B (with GRAM domain)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015043.3-1170s1c1
Sequence:CCGGCCAACCTGAAAGACCGTGATTCTCGAGAATCACGGTCTTTCAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015043.3-2456s1c1
Sequence:CCGGCGAGCTATACCTGTGGACATTCTCGAGAATGTCCACAGGTATAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015043.3-370s1c1
Sequence:CCGGCAAGGGCAAGATACACGGAATCTCGAGATTCCGTGTATCTTGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015043.3-2216s1c1
Sequence:CCGGCTGGGCAGATACCTGGATAATCTCGAGATTATCCAGGTATCTGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015043.3-2335s1c1
Sequence:CCGGCCTGAAAGTGTCCTATGAGAACTCGAGTTCTCATAGGACACTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015043.3-3070s21c1
Sequence:CCGGTGAGCTGTGCAAGACGCTTTACTCGAGTAAAGCGTCTTGCACAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015043.3-1170s21c1
Sequence:CCGGCCAACCTGAAAGACCGTGATTCTCGAGAATCACGGTCTTTCAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015043.3-370s21c1
Sequence:CCGGCAAGGGCAAGATACACGGAATCTCGAGATTCCGTGTATCTTGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015043.3-2456s21c1
Sequence:CCGGCGAGCTATACCTGTGGACATTCTCGAGAATGTCCACAGGTATAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015043.3-4012s21c1
Sequence:CCGGAGCTGCACCTGCCTAGCATTACTCGAGTAATGCTAGGCAGGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015043.3-2381s21c1
Sequence:CCGGATTGAGCAGATGCGGTTTAAACTCGAGTTTAAACCGCATCTGCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029745
VALIDATED
TBC1D9B MISSION shRNA Bacterial Glycerol Stock
TBC1 domain family, member 9B (with GRAM domain)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029745.2-2533s21c1
Sequence:CCGGTGAAGAGCTGGAGGATCTTTACTCGAGTAAAGATCCTCCAGCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029745.2-4493s21c1
Sequence:CCGGTCTTCCCAAGTCAGGTATATGCTCGAGCATATACCTGACTTGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029745.2-2426s21c1
Sequence:CCGGATTGAACAGATGCGGTTTAAACTCGAGTTTAAACCGCATCTGTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029745.2-781s21c1
Sequence:CCGGTGGCGAGACCTTCAAGCTTATCTCGAGATAAGCTTGAAGGTCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029745.2-1832s21c1
Sequence:CCGGGCCTTCCGAAACCCTACTATTCTCGAGAATAGTAGGGTTTCGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029745
VALIDATED
TBC1D9B MISSION shRNA shRNA Plasmid DNA
TBC1 domain family, member 9B (with GRAM domain)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029745.2-2533s21c1
Sequence:CCGGTGAAGAGCTGGAGGATCTTTACTCGAGTAAAGATCCTCCAGCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029745.2-4493s21c1
Sequence:CCGGTCTTCCCAAGTCAGGTATATGCTCGAGCATATACCTGACTTGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029745.2-2426s21c1
Sequence:CCGGATTGAACAGATGCGGTTTAAACTCGAGTTTAAACCGCATCTGTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029745.2-781s21c1
Sequence:CCGGTGGCGAGACCTTCAAGCTTATCTCGAGATAAGCTTGAAGGTCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029745.2-1832s21c1
Sequence:CCGGGCCTTCCGAAACCCTACTATTCTCGAGAATAGTAGGGTTTCGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029745
VALIDATED
TBC1D9B MISSION shRNA Lentiviral Transduction Particles
TBC1 domain family, member 9B (with GRAM domain)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029745.2-2533s21c1
Sequence:CCGGTGAAGAGCTGGAGGATCTTTACTCGAGTAAAGATCCTCCAGCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029745.2-4493s21c1
Sequence:CCGGTCTTCCCAAGTCAGGTATATGCTCGAGCATATACCTGACTTGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029745.2-2426s21c1
Sequence:CCGGATTGAACAGATGCGGTTTAAACTCGAGTTTAAACCGCATCTGTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029745.2-781s21c1
Sequence:CCGGTGGCGAGACCTTCAAGCTTATCTCGAGATAAGCTTGAAGGTCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029745.2-1832s21c1
Sequence:CCGGGCCTTCCGAAACCCTACTATTCTCGAGAATAGTAGGGTTTCGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks