EMAIL THIS PAGE TO A FRIEND

TBCA

tubulin folding cofactor A

UniProtKB ID: O75347
Gene ID:
Human(6902) Summary: The product of this gene is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. This gene encodes chaperonin cofactor A. [provided by RefSeq, Jul 2008]
Mouse(21371) tubulin cofactor A
Rat(366995) tubulin folding cofactor A
Zebrafish(394029) tubulin cofactor a
chicken(416367) tubulin folding cofactor A
domestic cat(101083906) tubulin folding cofactor A
dog(479173) tubulin folding cofactor A
cow(327683) tubulin folding cofactor A
sheep(101107793) tubulin folding cofactor A
naked mole-rat(101715358) tubulin folding cofactor A
domestic guinea pig(100718085) tubulin folding cofactor A
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004607 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009321 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009321 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009321 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126951 MISSION® esiRNA esiRNA human TBCA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004607 Rosetta Predictions human pricing
NM_001013245 Rosetta Predictions rat pricing
NM_009321 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241548 predicted 514
2 SASI_Hs01_00241550 predicted 499
3 SASI_Hs01_00241551 predicted 388
4 SASI_Hs01_00241552 predicted 559
5 SASI_Hs01_00241554 predicted 409
6 SASI_Hs01_00241555 predicted 282
7 SASI_Hs01_00241549 predicted 512
8 SASI_Hs02_00337986 predicted 258
9 SASI_Hs01_00241556 predicted 318
10 SASI_Hs01_00241557 predicted 317
11 SASI_Hs01_00241553 predicted 108
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013245 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201069 predicted 244
2 SASI_Rn01_00064029 predicted 221
3 SASI_Rn01_00064030 predicted 224
4 SASI_Rn01_00064031 predicted 221
5 SASI_Rn02_00201070 predicted 309
6 SASI_Rn01_00064032 predicted 255
7 SASI_Rn01_00064034 predicted 256
8 SASI_Rn01_00064035 predicted 235
9 SASI_Rn01_00064037 predicted 212
10 SASI_Rn01_00064038 predicted 225
11 SASI_Rn01_00064033 predicted 315
12 SASI_Rn01_00064036 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132379 predicted 217
2 SASI_Mm01_00132380 predicted 216
3 SASI_Mm01_00132381 predicted 183
4 SASI_Mm01_00132382 predicted 304
5 SASI_Mm01_00132383 predicted 298
6 SASI_Mm01_00132384 predicted 371
7 SASI_Mm01_00132385 predicted 218
8 SASI_Mm01_00132386 predicted 267
9 SASI_Mm01_00132387 predicted 151
10 SASI_Mm01_00132388 predicted 403
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004607
TBCA MISSION shRNA Bacterial Glycerol Stock
tubulin folding cofactor A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004607.2-392s21c1
Sequence:CCGGAGCACGTTTAGTACTGGATTCCTCGAGGAATCCAGTACTAAACGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004607.2-505s21c1
Sequence:CCGGGCTATGTGTTCAAGTAGTATGCTCGAGCATACTACTTGAACACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004607.2-148s21c1
Sequence:CCGGTGGTGAAGCGGTTGGTCAAAGCTCGAGCTTTGACCAACCGCTTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004607.2-334s21c1
Sequence:CCGGATCTTCAACGGATACTAGAAACTCGAGTTTCTAGTATCCGTTGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004607.1-256s1c1
Sequence:CCGGCAGGTTGGAAGCCGCATATTTCTCGAGAAATATGCGGCTTCCAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004607.1-266s1c1
Sequence:CCGGGCCGCATATTTGGATCTTCAACTCGAGTTGAAGATCCAAATATGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004607.1-350s1c1
Sequence:CCGGCTGGATTCAGTGAAGTTAGAACTCGAGTTCTAACTTCACTGAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004607.1-323s1c1
Sequence:CCGGGAGGAATATAAAGAAGCACGTCTCGAGACGTGCTTCTTTATATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004607.1-308s1c1
Sequence:CCGGGACTTGGAAGAAGCTGAGGAACTCGAGTTCCTCAGCTTCTTCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004607.1-232s1c1
Sequence:CCGGGATGATGATCCCAGATTGCCACTCGAGTGGCAATCTGGGATCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004607
TBCA MISSION shRNA shRNA Plasmid DNA
tubulin folding cofactor A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004607.2-392s21c1
Sequence:CCGGAGCACGTTTAGTACTGGATTCCTCGAGGAATCCAGTACTAAACGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004607.2-505s21c1
Sequence:CCGGGCTATGTGTTCAAGTAGTATGCTCGAGCATACTACTTGAACACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004607.2-148s21c1
Sequence:CCGGTGGTGAAGCGGTTGGTCAAAGCTCGAGCTTTGACCAACCGCTTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004607.2-334s21c1
Sequence:CCGGATCTTCAACGGATACTAGAAACTCGAGTTTCTAGTATCCGTTGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004607.1-256s1c1
Sequence:CCGGCAGGTTGGAAGCCGCATATTTCTCGAGAAATATGCGGCTTCCAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004607.1-266s1c1
Sequence:CCGGGCCGCATATTTGGATCTTCAACTCGAGTTGAAGATCCAAATATGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004607.1-350s1c1
Sequence:CCGGCTGGATTCAGTGAAGTTAGAACTCGAGTTCTAACTTCACTGAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004607.1-323s1c1
Sequence:CCGGGAGGAATATAAAGAAGCACGTCTCGAGACGTGCTTCTTTATATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004607.1-308s1c1
Sequence:CCGGGACTTGGAAGAAGCTGAGGAACTCGAGTTCCTCAGCTTCTTCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004607.1-232s1c1
Sequence:CCGGGATGATGATCCCAGATTGCCACTCGAGTGGCAATCTGGGATCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004607
TBCA MISSION shRNA Lentiviral Transduction Particles
tubulin folding cofactor A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004607.2-392s21c1
Sequence:CCGGAGCACGTTTAGTACTGGATTCCTCGAGGAATCCAGTACTAAACGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004607.2-505s21c1
Sequence:CCGGGCTATGTGTTCAAGTAGTATGCTCGAGCATACTACTTGAACACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004607.2-148s21c1
Sequence:CCGGTGGTGAAGCGGTTGGTCAAAGCTCGAGCTTTGACCAACCGCTTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004607.2-334s21c1
Sequence:CCGGATCTTCAACGGATACTAGAAACTCGAGTTTCTAGTATCCGTTGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004607.1-256s1c1
Sequence:CCGGCAGGTTGGAAGCCGCATATTTCTCGAGAAATATGCGGCTTCCAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004607.1-266s1c1
Sequence:CCGGGCCGCATATTTGGATCTTCAACTCGAGTTGAAGATCCAAATATGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004607.1-350s1c1
Sequence:CCGGCTGGATTCAGTGAAGTTAGAACTCGAGTTCTAACTTCACTGAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004607.1-323s1c1
Sequence:CCGGGAGGAATATAAAGAAGCACGTCTCGAGACGTGCTTCTTTATATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004607.1-308s1c1
Sequence:CCGGGACTTGGAAGAAGCTGAGGAACTCGAGTTCCTCAGCTTCTTCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004607.1-232s1c1
Sequence:CCGGGATGATGATCCCAGATTGCCACTCGAGTGGCAATCTGGGATCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009321
VALIDATED
TBCA MISSION shRNA Bacterial Glycerol Stock
tubulin folding cofactor A
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009321.2-286s21c1
Sequence:CCGGGTATAAAGAAGCCCGTGTAGTCTCGAGACTACACGGGCTTCTTTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009321.2-34s21c1
Sequence:CCGGCAAGATCAAGACCGGAGTAGTCTCGAGACTACTCCGGTCTTGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009321.2-236s21c1
Sequence:CCGGGATCTTCAGCAGATATTAGAACTCGAGTTCTAATATCTGCTGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009321.2-137s21c1
Sequence:CCGGGATGGAGAGAACTACGCCATTCTCGAGAATGGCGTAGTTCTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009321.2-217s21c1
Sequence:CCGGGTTAGAGGCTGCATATACTGACTCGAGTCAGTATATGCAGCCTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009321.1-60s1c1
Sequence:CCGGGATTGGTCAAAGAAAGAGTGACTCGAGTCACTCTTTCTTTGACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009321.1-228s1c1
Sequence:CCGGCATATACTGATCTTCAGCAGACTCGAGTCTGCTGAAGATCAGTATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009321.1-34s1c1
Sequence:CCGGCAAGATCAAGACCGGAGTAGTCTCGAGACTACTCCGGTCTTGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009321.1-92s1c1
Sequence:CCGGGAAGCAAAGCAGCAAGAAGAACTCGAGTTCTTCTTGCTGCTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009321.1-137s1c1
Sequence:CCGGGATGGAGAGAACTACGCCATTCTCGAGAATGGCGTAGTTCTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009321.1-217s1c1
Sequence:CCGGGTTAGAGGCTGCATATACTGACTCGAGTCAGTATATGCAGCCTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009321.1-58s1c1
Sequence:CCGGGCGATTGGTCAAAGAAAGAGTCTCGAGACTCTTTCTTTGACCAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009321.1-286s1c1
Sequence:CCGGGTATAAAGAAGCCCGTGTAGTCTCGAGACTACACGGGCTTCTTTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009321.1-236s1c1
Sequence:CCGGGATCTTCAGCAGATATTAGAACTCGAGTTCTAATATCTGCTGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009321
VALIDATED
TBCA MISSION shRNA shRNA Plasmid DNA
tubulin folding cofactor A
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009321.2-286s21c1
Sequence:CCGGGTATAAAGAAGCCCGTGTAGTCTCGAGACTACACGGGCTTCTTTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009321.2-34s21c1
Sequence:CCGGCAAGATCAAGACCGGAGTAGTCTCGAGACTACTCCGGTCTTGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009321.2-236s21c1
Sequence:CCGGGATCTTCAGCAGATATTAGAACTCGAGTTCTAATATCTGCTGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009321.2-137s21c1
Sequence:CCGGGATGGAGAGAACTACGCCATTCTCGAGAATGGCGTAGTTCTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009321.2-217s21c1
Sequence:CCGGGTTAGAGGCTGCATATACTGACTCGAGTCAGTATATGCAGCCTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009321.1-60s1c1
Sequence:CCGGGATTGGTCAAAGAAAGAGTGACTCGAGTCACTCTTTCTTTGACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009321.1-228s1c1
Sequence:CCGGCATATACTGATCTTCAGCAGACTCGAGTCTGCTGAAGATCAGTATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009321.1-34s1c1
Sequence:CCGGCAAGATCAAGACCGGAGTAGTCTCGAGACTACTCCGGTCTTGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009321.1-92s1c1
Sequence:CCGGGAAGCAAAGCAGCAAGAAGAACTCGAGTTCTTCTTGCTGCTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009321.1-137s1c1
Sequence:CCGGGATGGAGAGAACTACGCCATTCTCGAGAATGGCGTAGTTCTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009321.1-217s1c1
Sequence:CCGGGTTAGAGGCTGCATATACTGACTCGAGTCAGTATATGCAGCCTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009321.1-58s1c1
Sequence:CCGGGCGATTGGTCAAAGAAAGAGTCTCGAGACTCTTTCTTTGACCAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009321.1-286s1c1
Sequence:CCGGGTATAAAGAAGCCCGTGTAGTCTCGAGACTACACGGGCTTCTTTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009321.1-236s1c1
Sequence:CCGGGATCTTCAGCAGATATTAGAACTCGAGTTCTAATATCTGCTGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009321
VALIDATED
TBCA MISSION shRNA Lentiviral Transduction Particles
tubulin folding cofactor A
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009321.2-286s21c1
Sequence:CCGGGTATAAAGAAGCCCGTGTAGTCTCGAGACTACACGGGCTTCTTTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009321.2-34s21c1
Sequence:CCGGCAAGATCAAGACCGGAGTAGTCTCGAGACTACTCCGGTCTTGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009321.2-236s21c1
Sequence:CCGGGATCTTCAGCAGATATTAGAACTCGAGTTCTAATATCTGCTGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009321.2-137s21c1
Sequence:CCGGGATGGAGAGAACTACGCCATTCTCGAGAATGGCGTAGTTCTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009321.2-217s21c1
Sequence:CCGGGTTAGAGGCTGCATATACTGACTCGAGTCAGTATATGCAGCCTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009321.1-60s1c1
Sequence:CCGGGATTGGTCAAAGAAAGAGTGACTCGAGTCACTCTTTCTTTGACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009321.1-228s1c1
Sequence:CCGGCATATACTGATCTTCAGCAGACTCGAGTCTGCTGAAGATCAGTATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009321.1-34s1c1
Sequence:CCGGCAAGATCAAGACCGGAGTAGTCTCGAGACTACTCCGGTCTTGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009321.1-92s1c1
Sequence:CCGGGAAGCAAAGCAGCAAGAAGAACTCGAGTTCTTCTTGCTGCTTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009321.1-137s1c1
Sequence:CCGGGATGGAGAGAACTACGCCATTCTCGAGAATGGCGTAGTTCTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009321.1-217s1c1
Sequence:CCGGGTTAGAGGCTGCATATACTGACTCGAGTCAGTATATGCAGCCTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009321.1-58s1c1
Sequence:CCGGGCGATTGGTCAAAGAAAGAGTCTCGAGACTCTTTCTTTGACCAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009321.1-286s1c1
Sequence:CCGGGTATAAAGAAGCCCGTGTAGTCTCGAGACTACACGGGCTTCTTTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009321.1-236s1c1
Sequence:CCGGGATCTTCAGCAGATATTAGAACTCGAGTTCTAATATCTGCTGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks