EMAIL THIS PAGE TO A FRIEND

TBCB

tubulin folding cofactor B

Synonyms: CG22 CKAP1 CKAPI
UniProtKB ID: Q99426, O00111, O00674, O14728
Gene ID:
Mouse(66411) tubulin folding cofactor B
Rat(292777) tubulin folding cofactor B
fruit fly(37244) tubulin-binding cofactor B
Zebrafish(337350) tubulin folding cofactor B
domestic cat(101081941) tubulin folding cofactor B
dog(476475) tubulin folding cofactor B
domestic guinea pig(100727483) tubulin folding cofactor B
naked mole-rat(101713997) tubulin folding cofactor B
cow(530447) tubulin folding cofactor B
sheep(101118890) tubulin folding cofactor B
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025548 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025548 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025548 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001281 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001281 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001281 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001281 Rosetta Predictions human pricing
NM_001040180 Rosetta Predictions rat pricing
XM_001071286 Rosetta Predictions rat pricing
XM_001075678 Rosetta Predictions rat pricing
NM_025548 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121871 predicted 954
2 SASI_Hs01_00121872 predicted 1105
3 SASI_Hs01_00121873 predicted 907
4 SASI_Hs01_00121874 predicted 871
5 SASI_Hs01_00121875 predicted 671
6 SASI_Hs01_00121876 predicted 931
7 SASI_Hs01_00121877 predicted 1149
8 SASI_Hs01_00121878 predicted 1103
9 SASI_Hs01_00121879 predicted 736
10 SASI_Hs01_00121880 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040180 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045472 predicted 501
2 SASI_Rn02_00204907 predicted 480
3 SASI_Rn01_00045473 predicted 820
4 SASI_Rn01_00045474 predicted 807
5 SASI_Rn01_00045475 predicted 622
6 SASI_Rn01_00045476 predicted 592
7 SASI_Rn01_00045477 predicted 530
8 SASI_Rn02_00204908 predicted 454
9 SASI_Rn01_00045479 predicted 331
10 SASI_Rn01_00045480 predicted 767
11 SASI_Rn01_00045478 predicted 789
12 SASI_Rn01_00045481 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071286 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334520 predicted 877
2 SASI_Rn02_00334521 predicted 860
3 SASI_Rn02_00334522 predicted 1191
4 SASI_Rn02_00334523 predicted 1171
5 SASI_Rn02_00334524 predicted 990
6 SASI_Rn02_00334525 predicted 965
7 SASI_Rn02_00334526 predicted 904
8 SASI_Rn02_00334527 predicted 825
9 SASI_Rn02_00334528 predicted 1133
10 SASI_Rn02_00334529 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075678 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350675 predicted 873
2 SASI_Rn02_00350676 predicted 1262
3 SASI_Rn02_00350677 predicted 967
4 SASI_Rn02_00350678 predicted 900
5 SASI_Rn02_00350679 predicted 825
6 SASI_Rn02_00350680 predicted 705
7 SASI_Rn02_00350681 predicted 1139
8 SASI_Rn02_00350682 predicted 1176
9 SASI_Rn02_00350683 predicted 926
10 SASI_Rn02_00350684 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084487 predicted 913
2 SASI_Mm01_00084488 predicted 713
3 SASI_Mm01_00084486 predicted 559
4 SASI_Mm01_00084489 predicted 903
5 SASI_Mm01_00084490 predicted 624
6 SASI_Mm01_00084491 predicted 883
7 SASI_Mm01_00084492 predicted 688
8 SASI_Mm01_00084493 predicted 865
9 SASI_Mm01_00084494 predicted 654
10 SASI_Mm02_00328493 predicted 496
11 SASI_Mm01_00084485 predicted 334
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025548
VALIDATED
TBCB MISSION shRNA Bacterial Glycerol Stock
tubulin folding cofactor B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025548.1-195s1c1
Sequence:CCGGCGCAGAGTTCAAGTGTAAACTCTCGAGAGTTTACACTTGAACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025548.1-444s1c1
Sequence:CCGGGCAGAACACAGTTCGATCCTTCTCGAGAAGGATCGAACTGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025548.1-676s1c1
Sequence:CCGGGTCCGATATGATGAGCCGTTACTCGAGTAACGGCTCATCATATCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025548.1-715s1c1
Sequence:CCGGGTGAATGGGAAACGCTACTTTCTCGAGAAAGTAGCGTTTCCCATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025548.1-632s1c1
Sequence:CCGGTGTATGTAGGACTCACAGATTCTCGAGAATCTGTGAGTCCTACATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025548.3-958s21c1
Sequence:CCGGGTGAATGGGAAACGCTACTTTCTCGAGAAAGTAGCGTTTCCCATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025548.3-919s21c1
Sequence:CCGGGTCCGATATGATGAGCCGTTACTCGAGTAACGGCTCATCATATCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025548.3-687s21c1
Sequence:CCGGGCAGAACACAGTTCGATCCTTCTCGAGAAGGATCGAACTGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025548.3-438s21c1
Sequence:CCGGCGCAGAGTTCAAGTGTAAACTCTCGAGAGTTTACACTTGAACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025548.3-875s21c1
Sequence:CCGGTGTATGTAGGACTCACAGATTCTCGAGAATCTGTGAGTCCTACATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025548
VALIDATED
TBCB MISSION shRNA shRNA Plasmid DNA
tubulin folding cofactor B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025548.1-195s1c1
Sequence:CCGGCGCAGAGTTCAAGTGTAAACTCTCGAGAGTTTACACTTGAACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025548.1-444s1c1
Sequence:CCGGGCAGAACACAGTTCGATCCTTCTCGAGAAGGATCGAACTGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025548.1-676s1c1
Sequence:CCGGGTCCGATATGATGAGCCGTTACTCGAGTAACGGCTCATCATATCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025548.1-715s1c1
Sequence:CCGGGTGAATGGGAAACGCTACTTTCTCGAGAAAGTAGCGTTTCCCATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025548.1-632s1c1
Sequence:CCGGTGTATGTAGGACTCACAGATTCTCGAGAATCTGTGAGTCCTACATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025548.3-958s21c1
Sequence:CCGGGTGAATGGGAAACGCTACTTTCTCGAGAAAGTAGCGTTTCCCATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025548.3-919s21c1
Sequence:CCGGGTCCGATATGATGAGCCGTTACTCGAGTAACGGCTCATCATATCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025548.3-687s21c1
Sequence:CCGGGCAGAACACAGTTCGATCCTTCTCGAGAAGGATCGAACTGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025548.3-438s21c1
Sequence:CCGGCGCAGAGTTCAAGTGTAAACTCTCGAGAGTTTACACTTGAACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025548.3-875s21c1
Sequence:CCGGTGTATGTAGGACTCACAGATTCTCGAGAATCTGTGAGTCCTACATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025548
VALIDATED
TBCB MISSION shRNA Lentiviral Transduction Particles
tubulin folding cofactor B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025548.1-195s1c1
Sequence:CCGGCGCAGAGTTCAAGTGTAAACTCTCGAGAGTTTACACTTGAACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025548.1-444s1c1
Sequence:CCGGGCAGAACACAGTTCGATCCTTCTCGAGAAGGATCGAACTGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025548.1-676s1c1
Sequence:CCGGGTCCGATATGATGAGCCGTTACTCGAGTAACGGCTCATCATATCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025548.1-715s1c1
Sequence:CCGGGTGAATGGGAAACGCTACTTTCTCGAGAAAGTAGCGTTTCCCATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025548.1-632s1c1
Sequence:CCGGTGTATGTAGGACTCACAGATTCTCGAGAATCTGTGAGTCCTACATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025548.3-958s21c1
Sequence:CCGGGTGAATGGGAAACGCTACTTTCTCGAGAAAGTAGCGTTTCCCATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025548.3-919s21c1
Sequence:CCGGGTCCGATATGATGAGCCGTTACTCGAGTAACGGCTCATCATATCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025548.3-687s21c1
Sequence:CCGGGCAGAACACAGTTCGATCCTTCTCGAGAAGGATCGAACTGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025548.3-438s21c1
Sequence:CCGGCGCAGAGTTCAAGTGTAAACTCTCGAGAGTTTACACTTGAACTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025548.3-875s21c1
Sequence:CCGGTGTATGTAGGACTCACAGATTCTCGAGAATCTGTGAGTCCTACATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001281
VALIDATED
TBCB MISSION shRNA Bacterial Glycerol Stock
tubulin folding cofactor B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117032    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001281.2-1325s1c1
Sequence:CCGGCCCTGCTTCAGCTCCTAGCTCCTCGAGGAGCTAGGAGCTGAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001281.2-673s1c1
Sequence:CCGGCCATCGCTGAGTTCAAGTGTACTCGAGTACACTTGAACTCAGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001281.2-888s1c1
Sequence:CCGGGAGAAGTACACGATCTCACAACTCGAGTTGTGAGATCGTGTACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001281.2-1108s1c1
Sequence:CCGGCCGTCATGTATGTAGGTCTCACTCGAGTGAGACCTACATACATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001281.2-1127s1c1
Sequence:CCGGCACAGATTTCAAGCCTGGCTACTCGAGTAGCCAGGCTTGAAATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001281.2-1108s21c1
Sequence:CCGGCCGTCATGTATGTAGGTCTCACTCGAGTGAGACCTACATACATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001281.2-888s21c1
Sequence:CCGGGAGAAGTACACGATCTCACAACTCGAGTTGTGAGATCGTGTACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288850    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001281.2-1325s21c1
Sequence:CCGGCCCTGCTTCAGCTCCTAGCTCCTCGAGGAGCTAGGAGCTGAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001281.2-673s21c1
Sequence:CCGGCCATCGCTGAGTTCAAGTGTACTCGAGTACACTTGAACTCAGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001281.2-1127s21c1
Sequence:CCGGCACAGATTTCAAGCCTGGCTACTCGAGTAGCCAGGCTTGAAATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001281
VALIDATED
TBCB MISSION shRNA shRNA Plasmid DNA
tubulin folding cofactor B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117032    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001281.2-1325s1c1
Sequence:CCGGCCCTGCTTCAGCTCCTAGCTCCTCGAGGAGCTAGGAGCTGAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001281.2-673s1c1
Sequence:CCGGCCATCGCTGAGTTCAAGTGTACTCGAGTACACTTGAACTCAGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001281.2-888s1c1
Sequence:CCGGGAGAAGTACACGATCTCACAACTCGAGTTGTGAGATCGTGTACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001281.2-1108s1c1
Sequence:CCGGCCGTCATGTATGTAGGTCTCACTCGAGTGAGACCTACATACATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001281.2-1127s1c1
Sequence:CCGGCACAGATTTCAAGCCTGGCTACTCGAGTAGCCAGGCTTGAAATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001281.2-1108s21c1
Sequence:CCGGCCGTCATGTATGTAGGTCTCACTCGAGTGAGACCTACATACATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001281.2-888s21c1
Sequence:CCGGGAGAAGTACACGATCTCACAACTCGAGTTGTGAGATCGTGTACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288850    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001281.2-1325s21c1
Sequence:CCGGCCCTGCTTCAGCTCCTAGCTCCTCGAGGAGCTAGGAGCTGAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001281.2-673s21c1
Sequence:CCGGCCATCGCTGAGTTCAAGTGTACTCGAGTACACTTGAACTCAGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001281.2-1127s21c1
Sequence:CCGGCACAGATTTCAAGCCTGGCTACTCGAGTAGCCAGGCTTGAAATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001281
VALIDATED
TBCB MISSION shRNA Lentiviral Transduction Particles
tubulin folding cofactor B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117032    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001281.2-1325s1c1
Sequence:CCGGCCCTGCTTCAGCTCCTAGCTCCTCGAGGAGCTAGGAGCTGAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001281.2-673s1c1
Sequence:CCGGCCATCGCTGAGTTCAAGTGTACTCGAGTACACTTGAACTCAGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001281.2-888s1c1
Sequence:CCGGGAGAAGTACACGATCTCACAACTCGAGTTGTGAGATCGTGTACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001281.2-1108s1c1
Sequence:CCGGCCGTCATGTATGTAGGTCTCACTCGAGTGAGACCTACATACATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001281.2-1127s1c1
Sequence:CCGGCACAGATTTCAAGCCTGGCTACTCGAGTAGCCAGGCTTGAAATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001281.2-1108s21c1
Sequence:CCGGCCGTCATGTATGTAGGTCTCACTCGAGTGAGACCTACATACATGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001281.2-888s21c1
Sequence:CCGGGAGAAGTACACGATCTCACAACTCGAGTTGTGAGATCGTGTACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288850    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001281.2-1325s21c1
Sequence:CCGGCCCTGCTTCAGCTCCTAGCTCCTCGAGGAGCTAGGAGCTGAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001281.2-673s21c1
Sequence:CCGGCCATCGCTGAGTTCAAGTGTACTCGAGTACACTTGAACTCAGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001281.2-1127s21c1
Sequence:CCGGCACAGATTTCAAGCCTGGCTACTCGAGTAGCCAGGCTTGAAATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks