EMAIL THIS PAGE TO A FRIEND

TBCC

tubulin folding cofactor C

Synonyms: CFC
UniProtKB ID: Q15814, Q53Y43, Q5T787
Gene ID:
Human(6903) Summary: Cofactor C is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. [provided by RefSeq, Jul 2008]
Mouse(72726) tubulin-specific chaperone C
Rat(316221) tubulin folding cofactor C
cow(515354) tubulin folding cofactor C
sheep(101109835) tubulin folding cofactor C
naked mole-rat(101702058) tubulin folding cofactor C
domestic guinea pig(100713119) tubulin folding cofactor C
Zebrafish(449843) tubulin folding cofactor C
domestic cat(101081982) tubulin folding cofactor C
dog(481802) tubulin folding cofactor C
chicken(100310362) Blood cell count (total)
chicken(100309653) Blood cell count (total)
chicken(428567) tubulin folding cofactor C
chicken(100310325) Blood cell count (total)
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
V1377 Vinblastine sulfate salt powder, ≥96% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178385 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178385 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178385 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003192 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003192 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003192 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035681 MISSION® esiRNA esiRNA human TBCC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003192 Rosetta Predictions human pricing
NM_001108200 Rosetta Predictions rat pricing
NM_178385 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051563 predicted 839
2 SASI_Hs02_00335231 predicted 845
3 SASI_Hs02_00335232 predicted 742
4 SASI_Hs01_00051558 predicted 702
5 SASI_Hs01_00051559 predicted 1085
6 SASI_Hs01_00051560 predicted 698
7 SASI_Hs01_00051561 predicted 975
8 SASI_Hs01_00051562 predicted 713
9 SASI_Hs01_00051564 predicted 546
10 SASI_Hs01_00051565 predicted 970
11 SASI_Hs01_00051566 predicted 423
12 SASI_Hs01_00051567 predicted 931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108200 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236304 predicted 628
2 SASI_Rn02_00236305 predicted 392
3 SASI_Rn02_00236306 predicted 900
4 SASI_Rn02_00236307 predicted 921
5 SASI_Rn02_00236308 predicted 410
6 SASI_Rn02_00236309 predicted 888
7 SASI_Rn02_00236310 predicted 641
8 SASI_Rn02_00236311 predicted 278
9 SASI_Rn02_00236312 predicted 793
10 SASI_Rn02_00236313 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066408 predicted 1122
2 SASI_Mm01_00066409 predicted 1515
3 SASI_Mm01_00066410 predicted 1337
4 SASI_Mm01_00066411 predicted 1296
5 SASI_Mm02_00348793 predicted 1260
6 SASI_Mm01_00066413 predicted 1306
7 SASI_Mm01_00066414 predicted 1454
8 SASI_Mm01_00066415 predicted 1310
9 SASI_Mm01_00066416 predicted 1405
10 SASI_Mm01_00066417 predicted 1160
11 SASI_Mm01_00066412 predicted 789
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178385
VALIDATED
TBCC MISSION shRNA Bacterial Glycerol Stock
tubulin folding cofactor C
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178385.3-623s21c1
Sequence:CCGGAGTCCCAAGACCTGGAGAAGACTCGAGTCTTCTCCAGGTCTTGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178385.3-1385s21c1
Sequence:CCGGTCCATTAGCGGACGGTTTAAACTCGAGTTTAAACCGTCCGCTAATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178385.3-997s21c1
Sequence:CCGGTGGGACCAGGTTGATGATTTCCTCGAGGAAATCATCAACCTGGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178385.3-779s21c1
Sequence:CCGGCCTCTGTGTTTCTGGAGGATTCTCGAGAATCCTCCAGAAACACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178385.3-465s21c1
Sequence:CCGGCAAGAAGCGCTTCGCCTTCAACTCGAGTTGAAGGCGAAGCGCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178385.3-1044s21c1
Sequence:CCGGCCCAAACTGGAGTATTCTTCCCTCGAGGGAAGAATACTCCAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178385.3-1122s21c1
Sequence:CCGGCCATTCGGTTTACCTGATATTCTCGAGAATATCAGGTAAACCGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178385.2-908s1c1
Sequence:CCGGTCCGGTTTAGATAGGAGCAAACTCGAGTTTGCTCCTATCTAAACCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178385.2-98s1c1
Sequence:CCGGCGCGAACAGGAGAGGCAGATACTCGAGTATCTGCCTCTCCTGTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178385.2-1011s1c1
Sequence:CCGGAGAGAGACATCCAGTGGGATTCTCGAGAATCCCACTGGATGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178385.2-717s1c1
Sequence:CCGGCCTCTGTGTTTCTGGAGGATTCTCGAGAATCCTCCAGAAACACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178385.2-623s1c1
Sequence:CCGGCTGACCAACTGCACTGTCAAACTCGAGTTTGACAGTGCAGTTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178385
VALIDATED
TBCC MISSION shRNA shRNA Plasmid DNA
tubulin folding cofactor C
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178385.3-623s21c1
Sequence:CCGGAGTCCCAAGACCTGGAGAAGACTCGAGTCTTCTCCAGGTCTTGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178385.3-1385s21c1
Sequence:CCGGTCCATTAGCGGACGGTTTAAACTCGAGTTTAAACCGTCCGCTAATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178385.3-997s21c1
Sequence:CCGGTGGGACCAGGTTGATGATTTCCTCGAGGAAATCATCAACCTGGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178385.3-779s21c1
Sequence:CCGGCCTCTGTGTTTCTGGAGGATTCTCGAGAATCCTCCAGAAACACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178385.3-465s21c1
Sequence:CCGGCAAGAAGCGCTTCGCCTTCAACTCGAGTTGAAGGCGAAGCGCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178385.3-1044s21c1
Sequence:CCGGCCCAAACTGGAGTATTCTTCCCTCGAGGGAAGAATACTCCAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178385.3-1122s21c1
Sequence:CCGGCCATTCGGTTTACCTGATATTCTCGAGAATATCAGGTAAACCGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178385.2-908s1c1
Sequence:CCGGTCCGGTTTAGATAGGAGCAAACTCGAGTTTGCTCCTATCTAAACCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178385.2-98s1c1
Sequence:CCGGCGCGAACAGGAGAGGCAGATACTCGAGTATCTGCCTCTCCTGTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178385.2-1011s1c1
Sequence:CCGGAGAGAGACATCCAGTGGGATTCTCGAGAATCCCACTGGATGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178385.2-717s1c1
Sequence:CCGGCCTCTGTGTTTCTGGAGGATTCTCGAGAATCCTCCAGAAACACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178385.2-623s1c1
Sequence:CCGGCTGACCAACTGCACTGTCAAACTCGAGTTTGACAGTGCAGTTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178385
VALIDATED
TBCC MISSION shRNA Lentiviral Transduction Particles
tubulin folding cofactor C
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178385.3-623s21c1
Sequence:CCGGAGTCCCAAGACCTGGAGAAGACTCGAGTCTTCTCCAGGTCTTGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178385.3-1385s21c1
Sequence:CCGGTCCATTAGCGGACGGTTTAAACTCGAGTTTAAACCGTCCGCTAATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178385.3-997s21c1
Sequence:CCGGTGGGACCAGGTTGATGATTTCCTCGAGGAAATCATCAACCTGGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178385.3-779s21c1
Sequence:CCGGCCTCTGTGTTTCTGGAGGATTCTCGAGAATCCTCCAGAAACACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178385.3-465s21c1
Sequence:CCGGCAAGAAGCGCTTCGCCTTCAACTCGAGTTGAAGGCGAAGCGCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178385.3-1044s21c1
Sequence:CCGGCCCAAACTGGAGTATTCTTCCCTCGAGGGAAGAATACTCCAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178385.3-1122s21c1
Sequence:CCGGCCATTCGGTTTACCTGATATTCTCGAGAATATCAGGTAAACCGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178385.2-908s1c1
Sequence:CCGGTCCGGTTTAGATAGGAGCAAACTCGAGTTTGCTCCTATCTAAACCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178385.2-98s1c1
Sequence:CCGGCGCGAACAGGAGAGGCAGATACTCGAGTATCTGCCTCTCCTGTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178385.2-1011s1c1
Sequence:CCGGAGAGAGACATCCAGTGGGATTCTCGAGAATCCCACTGGATGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178385.2-717s1c1
Sequence:CCGGCCTCTGTGTTTCTGGAGGATTCTCGAGAATCCTCCAGAAACACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178385.2-623s1c1
Sequence:CCGGCTGACCAACTGCACTGTCAAACTCGAGTTTGACAGTGCAGTTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003192
TBCC MISSION shRNA Bacterial Glycerol Stock
tubulin folding cofactor C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113891    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003192.1-1224s1c1
Sequence:CCGGCGTAACAGGTATAACACTAAACTCGAGTTTAGTGTTATACCTGTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003192.1-135s1c1
Sequence:CCGGCTGGAAGTTGAAAGGCGGAAACTCGAGTTTCCGCCTTTCAACTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003192.1-937s1c1
Sequence:CCGGGCTCTGGTTTAGATAGGAGCACTCGAGTGCTCCTATCTAAACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003192.1-939s1c1
Sequence:CCGGTCTGGTTTAGATAGGAGCAAACTCGAGTTTGCTCCTATCTAAACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003192.1-804s1c1
Sequence:CCGGCTCCGCATACACAGTACGAAACTCGAGTTTCGTACTGTGTATGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003192
TBCC MISSION shRNA shRNA Plasmid DNA
tubulin folding cofactor C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113891    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003192.1-1224s1c1
Sequence:CCGGCGTAACAGGTATAACACTAAACTCGAGTTTAGTGTTATACCTGTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003192.1-135s1c1
Sequence:CCGGCTGGAAGTTGAAAGGCGGAAACTCGAGTTTCCGCCTTTCAACTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003192.1-937s1c1
Sequence:CCGGGCTCTGGTTTAGATAGGAGCACTCGAGTGCTCCTATCTAAACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003192.1-939s1c1
Sequence:CCGGTCTGGTTTAGATAGGAGCAAACTCGAGTTTGCTCCTATCTAAACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003192.1-804s1c1
Sequence:CCGGCTCCGCATACACAGTACGAAACTCGAGTTTCGTACTGTGTATGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003192
TBCC MISSION shRNA Lentiviral Transduction Particles
tubulin folding cofactor C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113891    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003192.1-1224s1c1
Sequence:CCGGCGTAACAGGTATAACACTAAACTCGAGTTTAGTGTTATACCTGTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003192.1-135s1c1
Sequence:CCGGCTGGAAGTTGAAAGGCGGAAACTCGAGTTTCCGCCTTTCAACTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003192.1-937s1c1
Sequence:CCGGGCTCTGGTTTAGATAGGAGCACTCGAGTGCTCCTATCTAAACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003192.1-939s1c1
Sequence:CCGGTCTGGTTTAGATAGGAGCAAACTCGAGTTTGCTCCTATCTAAACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003192.1-804s1c1
Sequence:CCGGCTCCGCATACACAGTACGAAACTCGAGTTTCGTACTGTGTATGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks