EMAIL THIS PAGE TO A FRIEND

TBCCD1

TBCC domain containing 1

UniProtKB ID: Q9NVR7, D3DNU6
Gene ID:
Mouse(70573) TBCC domain containing 1
Rat(303830) TBCC domain containing 1
Zebrafish(100037389) TBCC domain containing 1
chicken(424869) TBCC domain containing 1
dog(488117) TBCC domain containing 1
domestic cat(101100326) TBCC domain containing 1
Horse(100059422) TBCC domain containing 1
domestic guinea pig(100728919) TBCC domain containing 1
naked mole-rat(101724693) TBCC domain containing 1
Domestic Rabbit(100344081) TBCC domain containing 1
cow(538314) TBCC domain containing 1
sheep(101114152) TBCC domain containing 1
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304553 ANTI-TBCCD1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB2106048 Anti-TBCCD1, (N-terminal) antibody produced in rabbit affinity isolated antibody human, guinea pig, rabbit, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018138 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018138 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018138 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081368 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081368 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081368 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018138 Rosetta Predictions human pricing
NM_001012016 Rosetta Predictions rat pricing
XM_573311 Rosetta Predictions rat pricing
NM_001081368 Rosetta Predictions mouse pricing
XM_001480852 Rosetta Predictions mouse pricing
XM_900697 Rosetta Predictions mouse pricing
XM_923614 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060234 predicted 764
2 SASI_Hs01_00060235 predicted 1140
3 SASI_Hs01_00060236 predicted 1089
4 SASI_Hs01_00060238 predicted 1611
5 SASI_Hs01_00060239 predicted 1423
6 SASI_Hs01_00060240 predicted 1026
7 SASI_Hs01_00060241 predicted 1459
8 SASI_Hs01_00060242 predicted 879
9 SASI_Hs01_00060243 predicted 1162
10 SASI_Hs02_00351359 predicted 1308
11 SASI_Hs01_00060237 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012016 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054074 predicted 1205
2 SASI_Rn01_00054075 predicted 882
3 SASI_Rn01_00054076 predicted 289
4 SASI_Rn01_00054077 predicted 1485
5 SASI_Rn01_00054078 predicted 1018
6 SASI_Rn01_00054079 predicted 578
7 SASI_Rn01_00054080 predicted 1114
8 SASI_Rn01_00054081 predicted 479
9 SASI_Rn01_00054082 predicted 997
10 SASI_Rn01_00054083 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573311 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00168185 predicted 1095
2 SASI_Rn01_00168186 predicted 916
3 SASI_Rn01_00168187 predicted 322
4 SASI_Rn01_00168188 predicted 1053
5 SASI_Rn01_00168189 predicted 616
6 SASI_Rn01_00168190 predicted 801
7 SASI_Rn01_00168191 predicted 1149
8 SASI_Rn01_00168192 predicted 520
9 SASI_Rn01_00168193 predicted 1030
10 SASI_Rn01_00168194 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081368 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297731 predicted 280
2 SASI_Mm02_00297732 predicted 1480
3 SASI_Mm02_00297733 predicted 473
4 SASI_Mm02_00297734 predicted 583
5 SASI_Mm02_00297735 predicted 740
6 SASI_Mm02_00297736 predicted 725
7 SASI_Mm02_00297737 predicted 1755
8 SASI_Mm02_00297738 predicted 451
9 SASI_Mm02_00297739 predicted 1785
10 SASI_Mm02_00297740 predicted 1737
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00420294 predicted 1535
2 SASI_Mm02_00420295 predicted 1804
3 SASI_Mm02_00420296 predicted 1834
4 SASI_Mm02_00420297 predicted 1791
5 SASI_Mm02_00420298 predicted 1289
6 SASI_Mm02_00420299 predicted 1643
7 SASI_Mm02_00420300 predicted 1087
8 SASI_Mm02_00420301 predicted 1361
9 SASI_Mm02_00420302 predicted 1503
10 SASI_Mm02_00420303 predicted 1663
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900697 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241058 predicted 1815
2 SASI_Mm01_00241059 predicted 1840
3 SASI_Mm01_00241060 predicted 1065
4 SASI_Mm01_00241061 predicted 1800
5 SASI_Mm01_00241062 predicted 1294
6 SASI_Mm01_00241063 predicted 1721
7 SASI_Mm01_00241064 predicted 1093
8 SASI_Mm01_00241065 predicted 1369
9 SASI_Mm01_00241066 predicted 1512
10 SASI_Mm01_00241067 predicted 1668
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_923614 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00443919 predicted 336
2 SASI_Mm02_00443920 predicted 1533
3 SASI_Mm02_00443921 predicted 523
4 SASI_Mm02_00443922 predicted 639
5 SASI_Mm02_00443923 predicted 784
6 SASI_Mm02_00443924 predicted 1811
7 SASI_Mm02_00443925 predicted 505
8 SASI_Mm02_00443926 predicted 1839
9 SASI_Mm02_00443927 predicted 1795
10 SASI_Mm02_00443928 predicted 1289
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018138
VALIDATED
TBCCD1 MISSION shRNA Bacterial Glycerol Stock
TBCC domain containing 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018138.1-1244s1c1
Sequence:CCGGCATTGCTGTTTGCCATCGTTTCTCGAGAAACGATGGCAAACAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018138.1-889s1c1
Sequence:CCGGCCTGTTTGACTGGGAATCCATCTCGAGATGGATTCCCAGTCAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018138.1-1141s1c1
Sequence:CCGGCTCCCTTACGATCTGTGACAACTCGAGTTGTCACAGATCGTAAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018138.1-452s1c1
Sequence:CCGGCACGCTACAGTTTCTGCTCTTCTCGAGAAGAGCAGAAACTGTAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018138.1-1373s1c1
Sequence:CCGGCCCAATGCTAGAGGACCATATCTCGAGATATGGTCCTCTAGCATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_018138.1-1632s1c1
Sequence:CCGGGAGGCTCATTTGACAAAGGATCTCGAGATCCTTTGTCAAATGAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018138.1-1801s1c1
Sequence:CCGGGCCCTGGAAATACAAGGATAACTCGAGTTATCCTTGTATTTCCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018138.1-742s1c1
Sequence:CCGGGCTTCCTTATTGAAGGTACAACTCGAGTTGTACCTTCAATAAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018138.1-1285s1c1
Sequence:CCGGGTTGCATCTTTCACGTTCTTACTCGAGTAAGAACGTGAAAGATGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018138.3-791s21c1
Sequence:CCGGGTAGAGCCAGGAAGATCTATCCTCGAGGATAGATCTTCCTGGCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018138.3-1442s21c1
Sequence:CCGGTGCCTAACTATTGGGATAATCCTCGAGGATTATCCCAATAGTTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018138.3-1792s21c1
Sequence:CCGGGCAGCTGGATAAGGATCTTACCTCGAGGTAAGATCCTTATCCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018138.3-234s21c1
Sequence:CCGGGATATCCACCTATGTGCAAATCTCGAGATTTGCACATAGGTGGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018138
VALIDATED
TBCCD1 MISSION shRNA shRNA Plasmid DNA
TBCC domain containing 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018138.1-1244s1c1
Sequence:CCGGCATTGCTGTTTGCCATCGTTTCTCGAGAAACGATGGCAAACAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018138.1-889s1c1
Sequence:CCGGCCTGTTTGACTGGGAATCCATCTCGAGATGGATTCCCAGTCAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018138.1-1141s1c1
Sequence:CCGGCTCCCTTACGATCTGTGACAACTCGAGTTGTCACAGATCGTAAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018138.1-452s1c1
Sequence:CCGGCACGCTACAGTTTCTGCTCTTCTCGAGAAGAGCAGAAACTGTAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018138.1-1373s1c1
Sequence:CCGGCCCAATGCTAGAGGACCATATCTCGAGATATGGTCCTCTAGCATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_018138.1-1632s1c1
Sequence:CCGGGAGGCTCATTTGACAAAGGATCTCGAGATCCTTTGTCAAATGAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018138.1-1801s1c1
Sequence:CCGGGCCCTGGAAATACAAGGATAACTCGAGTTATCCTTGTATTTCCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018138.1-742s1c1
Sequence:CCGGGCTTCCTTATTGAAGGTACAACTCGAGTTGTACCTTCAATAAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018138.1-1285s1c1
Sequence:CCGGGTTGCATCTTTCACGTTCTTACTCGAGTAAGAACGTGAAAGATGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018138.3-791s21c1
Sequence:CCGGGTAGAGCCAGGAAGATCTATCCTCGAGGATAGATCTTCCTGGCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018138.3-1442s21c1
Sequence:CCGGTGCCTAACTATTGGGATAATCCTCGAGGATTATCCCAATAGTTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018138.3-1792s21c1
Sequence:CCGGGCAGCTGGATAAGGATCTTACCTCGAGGTAAGATCCTTATCCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018138.3-234s21c1
Sequence:CCGGGATATCCACCTATGTGCAAATCTCGAGATTTGCACATAGGTGGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018138
VALIDATED
TBCCD1 MISSION shRNA Lentiviral Transduction Particles
TBCC domain containing 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018138.1-1244s1c1
Sequence:CCGGCATTGCTGTTTGCCATCGTTTCTCGAGAAACGATGGCAAACAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018138.1-889s1c1
Sequence:CCGGCCTGTTTGACTGGGAATCCATCTCGAGATGGATTCCCAGTCAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018138.1-1141s1c1
Sequence:CCGGCTCCCTTACGATCTGTGACAACTCGAGTTGTCACAGATCGTAAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018138.1-452s1c1
Sequence:CCGGCACGCTACAGTTTCTGCTCTTCTCGAGAAGAGCAGAAACTGTAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018138.1-1373s1c1
Sequence:CCGGCCCAATGCTAGAGGACCATATCTCGAGATATGGTCCTCTAGCATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_018138.1-1632s1c1
Sequence:CCGGGAGGCTCATTTGACAAAGGATCTCGAGATCCTTTGTCAAATGAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018138.1-1801s1c1
Sequence:CCGGGCCCTGGAAATACAAGGATAACTCGAGTTATCCTTGTATTTCCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018138.1-742s1c1
Sequence:CCGGGCTTCCTTATTGAAGGTACAACTCGAGTTGTACCTTCAATAAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018138.1-1285s1c1
Sequence:CCGGGTTGCATCTTTCACGTTCTTACTCGAGTAAGAACGTGAAAGATGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018138.3-791s21c1
Sequence:CCGGGTAGAGCCAGGAAGATCTATCCTCGAGGATAGATCTTCCTGGCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018138.3-1442s21c1
Sequence:CCGGTGCCTAACTATTGGGATAATCCTCGAGGATTATCCCAATAGTTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018138.3-1792s21c1
Sequence:CCGGGCAGCTGGATAAGGATCTTACCTCGAGGTAAGATCCTTATCCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018138.3-234s21c1
Sequence:CCGGGATATCCACCTATGTGCAAATCTCGAGATTTGCACATAGGTGGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081368
TBCCD1 MISSION shRNA Bacterial Glycerol Stock
TBCC domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081368.1-2511s21c1
Sequence:CCGGTGGTCAGTTGGTGCATAAATACTCGAGTATTTATGCACCAACTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081368.1-1572s21c1
Sequence:CCGGTTGCTACAGTGCCTAACTATTCTCGAGAATAGTTAGGCACTGTAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081368.1-535s21c1
Sequence:CCGGACGCCTGGAATGGTCTGAAATCTCGAGATTTCAGACCATTCCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081368.1-1468s21c1
Sequence:CCGGGACACCTTCACGTCCACTTATCTCGAGATAAGTGGACGTGAAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081368.1-1307s21c1
Sequence:CCGGCCCTTACGATCCATGACAATTCTCGAGAATTGTCATGGATCGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081368
TBCCD1 MISSION shRNA shRNA Plasmid DNA
TBCC domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081368.1-2511s21c1
Sequence:CCGGTGGTCAGTTGGTGCATAAATACTCGAGTATTTATGCACCAACTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081368.1-1572s21c1
Sequence:CCGGTTGCTACAGTGCCTAACTATTCTCGAGAATAGTTAGGCACTGTAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081368.1-535s21c1
Sequence:CCGGACGCCTGGAATGGTCTGAAATCTCGAGATTTCAGACCATTCCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081368.1-1468s21c1
Sequence:CCGGGACACCTTCACGTCCACTTATCTCGAGATAAGTGGACGTGAAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081368.1-1307s21c1
Sequence:CCGGCCCTTACGATCCATGACAATTCTCGAGAATTGTCATGGATCGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081368
TBCCD1 MISSION shRNA Lentiviral Transduction Particles
TBCC domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081368.1-2511s21c1
Sequence:CCGGTGGTCAGTTGGTGCATAAATACTCGAGTATTTATGCACCAACTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081368.1-1572s21c1
Sequence:CCGGTTGCTACAGTGCCTAACTATTCTCGAGAATAGTTAGGCACTGTAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081368.1-535s21c1
Sequence:CCGGACGCCTGGAATGGTCTGAAATCTCGAGATTTCAGACCATTCCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081368.1-1468s21c1
Sequence:CCGGGACACCTTCACGTCCACTTATCTCGAGATAAGTGGACGTGAAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081368.1-1307s21c1
Sequence:CCGGCCCTTACGATCCATGACAATTCTCGAGAATTGTCATGGATCGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks