EMAIL THIS PAGE TO A FRIEND

TBCD

tubulin folding cofactor D

Synonyms: SSD-1 tfcD
Gene ID:
Human(6904) Summary: Cofactor D is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. [provided by RefSeq, Jul 2008]
Mouse(108903) tubulin-specific chaperone d
Rat(100361417) tubulin folding cofactor D
Zebrafish(553265) tubulin-specific chaperone d
domestic cat(101084074) tubulin folding cofactor D
dog(491683) tubulin folding cofactor D
chicken(417334) tubulin folding cofactor D
cow(281515) tubulin folding cofactor D
sheep(101108144) tubulin folding cofactor D
Domestic Rabbit(100344782) tubulin folding cofactor D
naked mole-rat(101710880) tubulin folding cofactor D
domestic guinea pig(100718837) tubulin folding cofactor D
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005993 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005993 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005993 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029878 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029878 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029878 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033052 Rosetta Predictions human pricing
NM_005993 Rosetta Predictions human pricing
NM_029878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033052 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140487 predicted 1894
2 SASI_Hs01_00140488 predicted 2004
3 SASI_Hs01_00140489 predicted 597
4 SASI_Hs01_00140490 predicted 580
5 SASI_Hs01_00140491 predicted 1515
6 SASI_Hs01_00140492 predicted 1982
7 SASI_Hs01_00140493 predicted 1689
8 SASI_Hs01_00140494 predicted 1042
9 SASI_Hs01_00140495 predicted 811
10 SASI_Hs01_00140496 predicted 1200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005993 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340687 predicted 2254
2 SASI_Hs01_00063223 predicted 2010
3 SASI_Hs02_00340688 predicted 2202
4 SASI_Hs02_00340689 predicted 453
5 SASI_Hs02_00340690 predicted 2000
6 SASI_Hs02_00340691 predicted 2331
7 SASI_Hs02_00340692 predicted 383
8 SASI_Hs02_00340693 predicted 2858
9 SASI_Hs01_00063229 predicted 1798
10 SASI_Hs02_00340694 predicted 1755
11 SASI_Hs01_00063224 predicted 2117
12 SASI_Hs01_00063225 predicted 720
13 SASI_Hs01_00063226 predicted 696
14 SASI_Hs01_00063227 predicted 1629
15 SASI_Hs01_00063228 predicted 2102
16 SASI_Hs01_00063230 predicted 1156
17 SASI_Hs01_00063231 predicted 925
18 SASI_Hs01_00063232 predicted 1318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114802 predicted 1862
2 SASI_Mm01_00114803 predicted 3198
3 SASI_Mm01_00114804 predicted 2724
4 SASI_Mm01_00114805 predicted 3343
5 SASI_Mm01_00114806 predicted 617
6 SASI_Mm02_00336105 predicted 1656
7 SASI_Mm01_00114807 predicted 2495
8 SASI_Mm01_00114808 predicted 609
9 SASI_Mm01_00114809 predicted 1959
10 SASI_Mm01_00114810 predicted 2780
11 SASI_Mm01_00114811 predicted 3139
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005993
VALIDATED
TBCD MISSION shRNA Bacterial Glycerol Stock
tubulin folding cofactor D
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005993.4-1720s21c1
Sequence:CCGGTTTGACCACAGCTGACTATTTCTCGAGAAATAGTCAGCTGTGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005993.4-1747s21c1
Sequence:CCGGCGGTAACAGATCCAACTGTTTCTCGAGAAACAGTTGGATCTGTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005993.4-3915s21c1
Sequence:CCGGCACAAATGTGCTTCCTATAAACTCGAGTTTATAGGAAGCACATTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005993.4-458s21c1
Sequence:CCGGACCAAGGTTCGAGGCTATAAACTCGAGTTTATAGCCTCGAACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005993.4-2113s21c1
Sequence:CCGGGCTCTATGATCGTCAGTTATACTCGAGTATAACTGACGATCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005993.4-2223s21c1
Sequence:CCGGCCGTAATTGATGGTTGGCAATCTCGAGATTGCCAACCATCAATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005993.3-4127s1c1
Sequence:CCGGCCAGTCTTGGAGAGAGATGAACTCGAGTTCATCTCTCTCCAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005993.3-2115s1c1
Sequence:CCGGGCTCTATGATCGTCAGTTATACTCGAGTATAACTGACGATCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005993.3-1749s1c1
Sequence:CCGGCGGTAACAGATCCAACTGTTTCTCGAGAAACAGTTGGATCTGTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005993.3-2225s1c1
Sequence:CCGGCCGTAATTGATGGTTGGCAATCTCGAGATTGCCAACCATCAATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005993.3-312s1c1
Sequence:CCGGCCGCGTAATAATGGACAAATACTCGAGTATTTGTCCATTATTACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005993
VALIDATED
TBCD MISSION shRNA shRNA Plasmid DNA
tubulin folding cofactor D
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005993.4-1720s21c1
Sequence:CCGGTTTGACCACAGCTGACTATTTCTCGAGAAATAGTCAGCTGTGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005993.4-1747s21c1
Sequence:CCGGCGGTAACAGATCCAACTGTTTCTCGAGAAACAGTTGGATCTGTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005993.4-3915s21c1
Sequence:CCGGCACAAATGTGCTTCCTATAAACTCGAGTTTATAGGAAGCACATTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005993.4-458s21c1
Sequence:CCGGACCAAGGTTCGAGGCTATAAACTCGAGTTTATAGCCTCGAACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005993.4-2113s21c1
Sequence:CCGGGCTCTATGATCGTCAGTTATACTCGAGTATAACTGACGATCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005993.4-2223s21c1
Sequence:CCGGCCGTAATTGATGGTTGGCAATCTCGAGATTGCCAACCATCAATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005993.3-4127s1c1
Sequence:CCGGCCAGTCTTGGAGAGAGATGAACTCGAGTTCATCTCTCTCCAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005993.3-2115s1c1
Sequence:CCGGGCTCTATGATCGTCAGTTATACTCGAGTATAACTGACGATCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005993.3-1749s1c1
Sequence:CCGGCGGTAACAGATCCAACTGTTTCTCGAGAAACAGTTGGATCTGTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005993.3-2225s1c1
Sequence:CCGGCCGTAATTGATGGTTGGCAATCTCGAGATTGCCAACCATCAATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005993.3-312s1c1
Sequence:CCGGCCGCGTAATAATGGACAAATACTCGAGTATTTGTCCATTATTACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005993
VALIDATED
TBCD MISSION shRNA Lentiviral Transduction Particles
tubulin folding cofactor D
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005993.4-1720s21c1
Sequence:CCGGTTTGACCACAGCTGACTATTTCTCGAGAAATAGTCAGCTGTGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005993.4-1747s21c1
Sequence:CCGGCGGTAACAGATCCAACTGTTTCTCGAGAAACAGTTGGATCTGTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005993.4-3915s21c1
Sequence:CCGGCACAAATGTGCTTCCTATAAACTCGAGTTTATAGGAAGCACATTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005993.4-458s21c1
Sequence:CCGGACCAAGGTTCGAGGCTATAAACTCGAGTTTATAGCCTCGAACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005993.4-2113s21c1
Sequence:CCGGGCTCTATGATCGTCAGTTATACTCGAGTATAACTGACGATCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005993.4-2223s21c1
Sequence:CCGGCCGTAATTGATGGTTGGCAATCTCGAGATTGCCAACCATCAATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005993.3-4127s1c1
Sequence:CCGGCCAGTCTTGGAGAGAGATGAACTCGAGTTCATCTCTCTCCAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005993.3-2115s1c1
Sequence:CCGGGCTCTATGATCGTCAGTTATACTCGAGTATAACTGACGATCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005993.3-1749s1c1
Sequence:CCGGCGGTAACAGATCCAACTGTTTCTCGAGAAACAGTTGGATCTGTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005993.3-2225s1c1
Sequence:CCGGCCGTAATTGATGGTTGGCAATCTCGAGATTGCCAACCATCAATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005993.3-312s1c1
Sequence:CCGGCCGCGTAATAATGGACAAATACTCGAGTATTTGTCCATTATTACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029878
VALIDATED
TBCD MISSION shRNA Bacterial Glycerol Stock
tubulin folding cofactor D
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029878.2-2685s21c1
Sequence:CCGGGCCTCATGGATTTGATGCTTTCTCGAGAAAGCATCAAATCCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029878.2-223s21c1
Sequence:CCGGCCGCGTAATTATGGACAAATACTCGAGTATTTGTCCATAATTACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029878.2-3682s21c1
Sequence:CCGGGCTTTACCATCATGGAAACTTCTCGAGAAGTTTCCATGATGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029878.2-1538s21c1
Sequence:CCGGGCTGCTGTATTTGACCGAAATCTCGAGATTTCGGTCAAATACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029878.1-3683s1c1
Sequence:CCGGGCTTTACCATCATGGAAACTTCTCGAGAAGTTTCCATGATGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029878.1-2774s1c1
Sequence:CCGGCCAGCAAGCAAGTGAGAAGATCTCGAGATCTTCTCACTTGCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029878.1-224s1c1
Sequence:CCGGCCGCGTAATTATGGACAAATACTCGAGTATTTGTCCATAATTACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029878.1-2686s1c1
Sequence:CCGGGCCTCATGGATTTGATGCTTTCTCGAGAAAGCATCAAATCCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029878.1-1539s1c1
Sequence:CCGGGCTGCTGTATTTGACCGAAATCTCGAGATTTCGGTCAAATACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029878
VALIDATED
TBCD MISSION shRNA shRNA Plasmid DNA
tubulin folding cofactor D
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029878.2-2685s21c1
Sequence:CCGGGCCTCATGGATTTGATGCTTTCTCGAGAAAGCATCAAATCCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029878.2-223s21c1
Sequence:CCGGCCGCGTAATTATGGACAAATACTCGAGTATTTGTCCATAATTACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029878.2-3682s21c1
Sequence:CCGGGCTTTACCATCATGGAAACTTCTCGAGAAGTTTCCATGATGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029878.2-1538s21c1
Sequence:CCGGGCTGCTGTATTTGACCGAAATCTCGAGATTTCGGTCAAATACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029878.1-3683s1c1
Sequence:CCGGGCTTTACCATCATGGAAACTTCTCGAGAAGTTTCCATGATGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029878.1-2774s1c1
Sequence:CCGGCCAGCAAGCAAGTGAGAAGATCTCGAGATCTTCTCACTTGCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029878.1-224s1c1
Sequence:CCGGCCGCGTAATTATGGACAAATACTCGAGTATTTGTCCATAATTACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029878.1-2686s1c1
Sequence:CCGGGCCTCATGGATTTGATGCTTTCTCGAGAAAGCATCAAATCCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029878.1-1539s1c1
Sequence:CCGGGCTGCTGTATTTGACCGAAATCTCGAGATTTCGGTCAAATACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029878
VALIDATED
TBCD MISSION shRNA Lentiviral Transduction Particles
tubulin folding cofactor D
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029878.2-2685s21c1
Sequence:CCGGGCCTCATGGATTTGATGCTTTCTCGAGAAAGCATCAAATCCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029878.2-223s21c1
Sequence:CCGGCCGCGTAATTATGGACAAATACTCGAGTATTTGTCCATAATTACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029878.2-3682s21c1
Sequence:CCGGGCTTTACCATCATGGAAACTTCTCGAGAAGTTTCCATGATGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029878.2-1538s21c1
Sequence:CCGGGCTGCTGTATTTGACCGAAATCTCGAGATTTCGGTCAAATACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029878.1-3683s1c1
Sequence:CCGGGCTTTACCATCATGGAAACTTCTCGAGAAGTTTCCATGATGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029878.1-2774s1c1
Sequence:CCGGCCAGCAAGCAAGTGAGAAGATCTCGAGATCTTCTCACTTGCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029878.1-224s1c1
Sequence:CCGGCCGCGTAATTATGGACAAATACTCGAGTATTTGTCCATAATTACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029878.1-2686s1c1
Sequence:CCGGGCCTCATGGATTTGATGCTTTCTCGAGAAAGCATCAAATCCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029878.1-1539s1c1
Sequence:CCGGGCTGCTGTATTTGACCGAAATCTCGAGATTTCGGTCAAATACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks