EMAIL THIS PAGE TO A FRIEND

TBCE

tubulin folding cofactor E

Synonyms: HRD KCS KCS1 pac2
UniProtKB ID: Q15813
Gene ID:
Human(6905) Summary: Cofactor E is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(70430) tubulin-specific chaperone E
Rat(361255) tubulin folding cofactor E
domestic guinea pig(100721439) tubulin folding cofactor E
naked mole-rat(101697898) tubulin folding cofactor E
Domestic Rabbit(100339504) tubulin folding cofactor E
cow(505066) tubulin folding cofactor E
sheep(101114670) tubulin folding cofactor E
fruit fly(35532) tubulin-specific chaperone E
domestic cat(101082185) tubulin folding cofactor E
dog(479197) tubulin folding cofactor E
chicken(426319) tubulin folding cofactor E
Zebrafish(664760) tubulin folding cofactor E
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003193 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003193 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003193 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178337 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178337 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178337 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079515 Rosetta Predictions human pricing
NM_003193 Rosetta Predictions human pricing
NM_001012161 Rosetta Predictions rat pricing
XM_574047 Rosetta Predictions rat pricing
NM_178337 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313390 predicted 1360
2 SASI_Hs02_00313391 predicted 1431
3 SASI_Hs02_00313392 predicted 466
4 SASI_Hs02_00313393 predicted 623
5 SASI_Hs02_00313394 predicted 760
6 SASI_Hs02_00313395 predicted 633
7 SASI_Hs02_00313396 predicted 1093
8 SASI_Hs02_00313397 predicted 1009
9 SASI_Hs02_00313398 predicted 1452
10 SASI_Hs02_00313399 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153971 predicted 1309
2 SASI_Hs02_00335233 predicted 1387
3 SASI_Hs01_00153972 predicted 425
4 SASI_Hs01_00153973 predicted 572
5 SASI_Hs01_00153974 predicted 706
6 SASI_Hs01_00153975 predicted 587
7 SASI_Hs01_00153976 predicted 1041
8 SASI_Hs01_00153977 predicted 960
9 SASI_Hs01_00153978 predicted 1397
10 SASI_Hs01_00153979 predicted 497
11 SASI_Hs01_00153980 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012161 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052300 predicted 1341
2 SASI_Rn01_00052301 predicted 1050
3 SASI_Rn01_00052303 predicted 410
4 SASI_Rn01_00052304 predicted 931
5 SASI_Rn02_00200352 predicted 348
6 SASI_Rn01_00052305 predicted 779
7 SASI_Rn01_00052306 predicted 1515
8 SASI_Rn01_00052307 predicted 398
9 SASI_Rn02_00200353 predicted 542
10 SASI_Rn01_00052309 predicted 1037
11 SASI_Rn01_00052302 predicted 459
12 SASI_Rn01_00052308 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574047 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00177345 predicted 1387
2 SASI_Rn01_00177346 predicted 1101
3 SASI_Rn01_00177347 predicted 500
4 SASI_Rn01_00177348 predicted 465
5 SASI_Rn01_00177349 predicted 982
6 SASI_Rn01_00177350 predicted 828
7 SASI_Rn01_00177351 predicted 1564
8 SASI_Rn01_00177352 predicted 445
9 SASI_Rn01_00177353 predicted 745
10 SASI_Rn01_00177354 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178337 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148010 predicted 1347
2 SASI_Mm01_00148012 predicted 807
3 SASI_Mm01_00148013 predicted 597
4 SASI_Mm01_00148014 predicted 1441
5 SASI_Mm01_00148015 predicted 792
6 SASI_Mm01_00148016 predicted 904
7 SASI_Mm01_00148017 predicted 864
8 SASI_Mm02_00348738 predicted 358
9 SASI_Mm01_00148018 predicted 1011
10 SASI_Mm01_00148019 predicted 712
11 SASI_Mm01_00148011 predicted 1309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003193
VALIDATED
TBCE MISSION shRNA Bacterial Glycerol Stock
tubulin folding cofactor E
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003193.2-1712s1c1
Sequence:CCGGGTTCACCGGAAATAAATGATTCTCGAGAATCATTTATTTCCGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003193.2-1409s1c1
Sequence:CCGGCCAGCTACTAACACTGAAGATCTCGAGATCTTCAGTGTTAGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003193.2-1362s1c1
Sequence:CCGGCCTGAAGATTGGGAACTCAAACTCGAGTTTGAGTTCCCAATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_003193.2-316s1c1
Sequence:CCGGCAGACTTTCTTACTGCAATTACTCGAGTAATTGCAGTAAGAAAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003193.2-999s1c1
Sequence:CCGGCCATCCTTGAAGTACCTGGTACTCGAGTACCAGGTACTTCAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003193.3-359s21c1
Sequence:CCGGCAGACTTTCTTACTGCAATTACTCGAGTAATTGCAGTAAGAAAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003193.3-1755s21c1
Sequence:CCGGGTTCACCGGAAATAAATGATTCTCGAGAATCATTTATTTCCGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003193.3-1405s21c1
Sequence:CCGGCCTGAAGATTGGGAACTCAAACTCGAGTTTGAGTTCCCAATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003193.3-1452s21c1
Sequence:CCGGCCAGCTACTAACACTGAAGATCTCGAGATCTTCAGTGTTAGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003193
VALIDATED
TBCE MISSION shRNA shRNA Plasmid DNA
tubulin folding cofactor E
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003193.2-1712s1c1
Sequence:CCGGGTTCACCGGAAATAAATGATTCTCGAGAATCATTTATTTCCGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003193.2-1409s1c1
Sequence:CCGGCCAGCTACTAACACTGAAGATCTCGAGATCTTCAGTGTTAGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003193.2-1362s1c1
Sequence:CCGGCCTGAAGATTGGGAACTCAAACTCGAGTTTGAGTTCCCAATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_003193.2-316s1c1
Sequence:CCGGCAGACTTTCTTACTGCAATTACTCGAGTAATTGCAGTAAGAAAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003193.2-999s1c1
Sequence:CCGGCCATCCTTGAAGTACCTGGTACTCGAGTACCAGGTACTTCAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003193.3-359s21c1
Sequence:CCGGCAGACTTTCTTACTGCAATTACTCGAGTAATTGCAGTAAGAAAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003193.3-1755s21c1
Sequence:CCGGGTTCACCGGAAATAAATGATTCTCGAGAATCATTTATTTCCGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003193.3-1405s21c1
Sequence:CCGGCCTGAAGATTGGGAACTCAAACTCGAGTTTGAGTTCCCAATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003193.3-1452s21c1
Sequence:CCGGCCAGCTACTAACACTGAAGATCTCGAGATCTTCAGTGTTAGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003193
VALIDATED
TBCE MISSION shRNA Lentiviral Transduction Particles
tubulin folding cofactor E
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003193.2-1712s1c1
Sequence:CCGGGTTCACCGGAAATAAATGATTCTCGAGAATCATTTATTTCCGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003193.2-1409s1c1
Sequence:CCGGCCAGCTACTAACACTGAAGATCTCGAGATCTTCAGTGTTAGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003193.2-1362s1c1
Sequence:CCGGCCTGAAGATTGGGAACTCAAACTCGAGTTTGAGTTCCCAATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_003193.2-316s1c1
Sequence:CCGGCAGACTTTCTTACTGCAATTACTCGAGTAATTGCAGTAAGAAAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003193.2-999s1c1
Sequence:CCGGCCATCCTTGAAGTACCTGGTACTCGAGTACCAGGTACTTCAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003193.3-359s21c1
Sequence:CCGGCAGACTTTCTTACTGCAATTACTCGAGTAATTGCAGTAAGAAAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003193.3-1755s21c1
Sequence:CCGGGTTCACCGGAAATAAATGATTCTCGAGAATCATTTATTTCCGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003193.3-1405s21c1
Sequence:CCGGCCTGAAGATTGGGAACTCAAACTCGAGTTTGAGTTCCCAATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003193.3-1452s21c1
Sequence:CCGGCCAGCTACTAACACTGAAGATCTCGAGATCTTCAGTGTTAGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178337
VALIDATED
TBCE MISSION shRNA Bacterial Glycerol Stock
tubulin folding cofactor E
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178337.1-1249s1c1
Sequence:CCGGCTTTGGAAATGAATGGAGAAACTCGAGTTTCTCCATTCATTTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115451    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178337.1-1674s1c1
Sequence:CCGGCCAACCGTAAGAGTTTAACGACTCGAGTCGTTAAACTCTTACGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178337.1-249s1c1
Sequence:CCGGGCCACGAAGGTACTATGTATTCTCGAGAATACATAGTACCTTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178337.1-686s1c1
Sequence:CCGGCCAACTCTAACTAGAACATTTCTCGAGAAATGTTCTAGTTAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178337.1-1248s1c1
Sequence:CCGGCCTTTGGAAATGAATGGAGAACTCGAGTTCTCCATTCATTTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178337.2-712s21c1
Sequence:CCGGTCTGAAGACTTTAGTCCTAAACTCGAGTTTAGGACTAAAGTCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178337.2-1140s21c1
Sequence:CCGGACAAAGCAGAGGAGATCATTACTCGAGTAATGATCTCCTCTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178337.2-798s21c1
Sequence:CCGGTTTACCTCAAGTCTAACAATACTCGAGTATTGTTAGACTTGAGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178337.2-303s21c1
Sequence:CCGGTTCGTCCAAGCAAAGTTAATTCTCGAGAATTAACTTTGCTTGGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178337.2-1050s21c1
Sequence:CCGGAGATATCAGAATGGTCATTTACTCGAGTAAATGACCATTCTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178337.2-1446s21c1
Sequence:CCGGATCAACCTGAACGGCAAATATCTCGAGATATTTGCCGTTCAGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178337.2-551s21c1
Sequence:CCGGCCCAATATTCGAGTTGTAAATCTCGAGATTTACAACTCGAATATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178337
VALIDATED
TBCE MISSION shRNA shRNA Plasmid DNA
tubulin folding cofactor E
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178337.1-1249s1c1
Sequence:CCGGCTTTGGAAATGAATGGAGAAACTCGAGTTTCTCCATTCATTTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115451    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178337.1-1674s1c1
Sequence:CCGGCCAACCGTAAGAGTTTAACGACTCGAGTCGTTAAACTCTTACGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178337.1-249s1c1
Sequence:CCGGGCCACGAAGGTACTATGTATTCTCGAGAATACATAGTACCTTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178337.1-686s1c1
Sequence:CCGGCCAACTCTAACTAGAACATTTCTCGAGAAATGTTCTAGTTAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178337.1-1248s1c1
Sequence:CCGGCCTTTGGAAATGAATGGAGAACTCGAGTTCTCCATTCATTTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178337.2-712s21c1
Sequence:CCGGTCTGAAGACTTTAGTCCTAAACTCGAGTTTAGGACTAAAGTCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178337.2-1140s21c1
Sequence:CCGGACAAAGCAGAGGAGATCATTACTCGAGTAATGATCTCCTCTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178337.2-798s21c1
Sequence:CCGGTTTACCTCAAGTCTAACAATACTCGAGTATTGTTAGACTTGAGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178337.2-303s21c1
Sequence:CCGGTTCGTCCAAGCAAAGTTAATTCTCGAGAATTAACTTTGCTTGGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178337.2-1050s21c1
Sequence:CCGGAGATATCAGAATGGTCATTTACTCGAGTAAATGACCATTCTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178337.2-1446s21c1
Sequence:CCGGATCAACCTGAACGGCAAATATCTCGAGATATTTGCCGTTCAGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178337.2-551s21c1
Sequence:CCGGCCCAATATTCGAGTTGTAAATCTCGAGATTTACAACTCGAATATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178337
VALIDATED
TBCE MISSION shRNA Lentiviral Transduction Particles
tubulin folding cofactor E
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178337.1-1249s1c1
Sequence:CCGGCTTTGGAAATGAATGGAGAAACTCGAGTTTCTCCATTCATTTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115451    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178337.1-1674s1c1
Sequence:CCGGCCAACCGTAAGAGTTTAACGACTCGAGTCGTTAAACTCTTACGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178337.1-249s1c1
Sequence:CCGGGCCACGAAGGTACTATGTATTCTCGAGAATACATAGTACCTTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178337.1-686s1c1
Sequence:CCGGCCAACTCTAACTAGAACATTTCTCGAGAAATGTTCTAGTTAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178337.1-1248s1c1
Sequence:CCGGCCTTTGGAAATGAATGGAGAACTCGAGTTCTCCATTCATTTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178337.2-712s21c1
Sequence:CCGGTCTGAAGACTTTAGTCCTAAACTCGAGTTTAGGACTAAAGTCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178337.2-1140s21c1
Sequence:CCGGACAAAGCAGAGGAGATCATTACTCGAGTAATGATCTCCTCTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178337.2-798s21c1
Sequence:CCGGTTTACCTCAAGTCTAACAATACTCGAGTATTGTTAGACTTGAGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178337.2-303s21c1
Sequence:CCGGTTCGTCCAAGCAAAGTTAATTCTCGAGAATTAACTTTGCTTGGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178337.2-1050s21c1
Sequence:CCGGAGATATCAGAATGGTCATTTACTCGAGTAAATGACCATTCTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178337.2-1446s21c1
Sequence:CCGGATCAACCTGAACGGCAAATATCTCGAGATATTTGCCGTTCAGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178337.2-551s21c1
Sequence:CCGGCCCAATATTCGAGTTGTAAATCTCGAGATTTACAACTCGAATATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks