EMAIL THIS PAGE TO A FRIEND

TBCEL

tubulin folding cofactor E-like

Synonyms: El LRRC35
UniProtKB ID: Q5QJ74, Q0VAN6
Gene ID:
Mouse(272589) tubulin folding cofactor E-like
Rat(315591) tubulin folding cofactor E-like
chicken(429536) tubulin folding cofactor E-like
Horse(100071538) tubulin folding cofactor E-like
domestic cat(101099241) tubulin folding cofactor E-like
dog(489358) tubulin folding cofactor E-like
cow(540781) tubulin folding cofactor E-like
sheep(101110865) tubulin folding cofactor E-like
naked mole-rat(101714990) tubulin folding cofactor E-like
domestic guinea pig(100715248) tubulin folding cofactor E-like
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152715 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152715 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152715 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173038 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173038 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173038 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152715 Rosetta Predictions human pricing
NM_001014089 Rosetta Predictions rat pricing
NM_173038 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043099 predicted 908
2 SASI_Hs01_00043100 predicted 1269
3 SASI_Hs01_00043101 predicted 581
4 SASI_Hs02_00366612 predicted 616
5 SASI_Hs01_00043102 predicted 1322
6 SASI_Hs01_00043103 predicted 212
7 SASI_Hs01_00043104 predicted 1121
8 SASI_Hs01_00043105 predicted 202
9 SASI_Hs01_00043106 predicted 413
10 SASI_Hs01_00043107 predicted 958
11 SASI_Hs01_00043108 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014089 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079494 predicted 596
2 SASI_Rn01_00079495 predicted 1038
3 SASI_Rn01_00079496 predicted 1170
4 SASI_Rn01_00079497 predicted 1113
5 SASI_Rn01_00079498 predicted 533
6 SASI_Rn01_00079499 predicted 758
7 SASI_Rn01_00079500 predicted 378
8 SASI_Rn01_00079502 predicted 730
9 SASI_Rn01_00079503 predicted 1163
10 SASI_Rn02_00201516 predicted 668
11 SASI_Rn01_00079501 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173038 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345106 predicted 449
2 SASI_Mm01_00101196 predicted 588
3 SASI_Mm01_00101197 predicted 1133
4 SASI_Mm01_00101198 predicted 905
5 SASI_Mm01_00101199 predicted 405
6 SASI_Mm01_00101200 predicted 565
7 SASI_Mm01_00101201 predicted 331
8 SASI_Mm01_00101202 predicted 560
9 SASI_Mm01_00101204 predicted 714
10 SASI_Mm01_00101205 predicted 496
11 SASI_Mm01_00101203 predicted 453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152715
TBCEL MISSION shRNA Bacterial Glycerol Stock
tubulin folding cofactor E-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152715.3-779s21c1
Sequence:CCGGATACGAAAGTTAGGAGTTATGCTCGAGCATAACTCCTAACTTTCGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152715.3-1019s21c1
Sequence:CCGGGAGCGAAGGAAATTGGTAATACTCGAGTATTACCAATTTCCTTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152715.1-1057s1c1
Sequence:CCGGGAAGTGCCATTCAGGTATCATCTCGAGATGATACCTGAATGGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152715.1-1159s1c1
Sequence:CCGGCACTTTAACGATCAGGTGGAACTCGAGTTCCACCTGATCGTTAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152715.1-608s1c1
Sequence:CCGGCAGTGTCTTGTCCTTCTATTTCTCGAGAAATAGAAGGACAAGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152715.1-957s1c1
Sequence:CCGGGCCATCAGTTTCCAAACTTAACTCGAGTTAAGTTTGGAAACTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152715.1-1327s1c1
Sequence:CCGGGCATTGCATTCCTTTGGCATTCTCGAGAATGCCAAAGGAATGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152715.1-1003s1c1
Sequence:CCGGCGAGAAGATTCTGAGAGATTTCTCGAGAAATCTCTCAGAATCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152715
TBCEL MISSION shRNA shRNA Plasmid DNA
tubulin folding cofactor E-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152715.3-779s21c1
Sequence:CCGGATACGAAAGTTAGGAGTTATGCTCGAGCATAACTCCTAACTTTCGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152715.3-1019s21c1
Sequence:CCGGGAGCGAAGGAAATTGGTAATACTCGAGTATTACCAATTTCCTTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152715.1-1057s1c1
Sequence:CCGGGAAGTGCCATTCAGGTATCATCTCGAGATGATACCTGAATGGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152715.1-1159s1c1
Sequence:CCGGCACTTTAACGATCAGGTGGAACTCGAGTTCCACCTGATCGTTAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152715.1-608s1c1
Sequence:CCGGCAGTGTCTTGTCCTTCTATTTCTCGAGAAATAGAAGGACAAGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152715.1-957s1c1
Sequence:CCGGGCCATCAGTTTCCAAACTTAACTCGAGTTAAGTTTGGAAACTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152715.1-1327s1c1
Sequence:CCGGGCATTGCATTCCTTTGGCATTCTCGAGAATGCCAAAGGAATGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152715.1-1003s1c1
Sequence:CCGGCGAGAAGATTCTGAGAGATTTCTCGAGAAATCTCTCAGAATCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152715
TBCEL MISSION shRNA Lentiviral Transduction Particles
tubulin folding cofactor E-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152715.3-779s21c1
Sequence:CCGGATACGAAAGTTAGGAGTTATGCTCGAGCATAACTCCTAACTTTCGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152715.3-1019s21c1
Sequence:CCGGGAGCGAAGGAAATTGGTAATACTCGAGTATTACCAATTTCCTTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152715.1-1057s1c1
Sequence:CCGGGAAGTGCCATTCAGGTATCATCTCGAGATGATACCTGAATGGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152715.1-1159s1c1
Sequence:CCGGCACTTTAACGATCAGGTGGAACTCGAGTTCCACCTGATCGTTAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152715.1-608s1c1
Sequence:CCGGCAGTGTCTTGTCCTTCTATTTCTCGAGAAATAGAAGGACAAGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152715.1-957s1c1
Sequence:CCGGGCCATCAGTTTCCAAACTTAACTCGAGTTAAGTTTGGAAACTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152715.1-1327s1c1
Sequence:CCGGGCATTGCATTCCTTTGGCATTCTCGAGAATGCCAAAGGAATGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152715.1-1003s1c1
Sequence:CCGGCGAGAAGATTCTGAGAGATTTCTCGAGAAATCTCTCAGAATCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173038
VALIDATED
TBCEL MISSION shRNA Bacterial Glycerol Stock
tubulin folding cofactor E-like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173038.3-452s1c1
Sequence:CCGGGTCAGTAAGATTGTGTCAAATCTCGAGATTTGACACAATCTTACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216402    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173038.3-4611s1c1
Sequence:CCGGGTTTGTATGTACGATAATTTCCTCGAGGAAATTATCGTACATACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173038.3-3245s21c1
Sequence:CCGGTATAGACGAGGACAGTTATTTCTCGAGAAATAACTGTCCTCGTCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173038.3-1132s21c1
Sequence:CCGGCAGGTATCATGAGCTCATTACCTCGAGGTAATGAGCTCATGATACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173038.3-964s21c1
Sequence:CCGGTCCTCTTCTACAGCCGTATACCTCGAGGTATACGGCTGTAGAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173038.3-1323s21c1
Sequence:CCGGGCATGCTTCTCTACTACTTTGCTCGAGCAAAGTAGTAGAGAAGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173038.3-403s21c1
Sequence:CCGGCGTGTCAGAACTCGATCTTTCCTCGAGGAAAGATCGAGTTCTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173038.1-1276s1c1
Sequence:CCGGGCCGAACTGAAGAAACAGCTACTCGAGTAGCTGTTTCTTCAGTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173038
VALIDATED
TBCEL MISSION shRNA shRNA Plasmid DNA
tubulin folding cofactor E-like
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173038.3-452s1c1
Sequence:CCGGGTCAGTAAGATTGTGTCAAATCTCGAGATTTGACACAATCTTACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216402    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173038.3-4611s1c1
Sequence:CCGGGTTTGTATGTACGATAATTTCCTCGAGGAAATTATCGTACATACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173038.3-3245s21c1
Sequence:CCGGTATAGACGAGGACAGTTATTTCTCGAGAAATAACTGTCCTCGTCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173038.3-1132s21c1
Sequence:CCGGCAGGTATCATGAGCTCATTACCTCGAGGTAATGAGCTCATGATACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173038.3-964s21c1
Sequence:CCGGTCCTCTTCTACAGCCGTATACCTCGAGGTATACGGCTGTAGAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173038.3-1323s21c1
Sequence:CCGGGCATGCTTCTCTACTACTTTGCTCGAGCAAAGTAGTAGAGAAGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173038.3-403s21c1
Sequence:CCGGCGTGTCAGAACTCGATCTTTCCTCGAGGAAAGATCGAGTTCTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173038.1-1276s1c1
Sequence:CCGGGCCGAACTGAAGAAACAGCTACTCGAGTAGCTGTTTCTTCAGTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173038
VALIDATED
TBCEL MISSION shRNA Lentiviral Transduction Particles
tubulin folding cofactor E-like
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173038.3-452s1c1
Sequence:CCGGGTCAGTAAGATTGTGTCAAATCTCGAGATTTGACACAATCTTACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216402    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173038.3-4611s1c1
Sequence:CCGGGTTTGTATGTACGATAATTTCCTCGAGGAAATTATCGTACATACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251964    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173038.3-3245s21c1
Sequence:CCGGTATAGACGAGGACAGTTATTTCTCGAGAAATAACTGTCCTCGTCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173038.3-1132s21c1
Sequence:CCGGCAGGTATCATGAGCTCATTACCTCGAGGTAATGAGCTCATGATACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173038.3-964s21c1
Sequence:CCGGTCCTCTTCTACAGCCGTATACCTCGAGGTATACGGCTGTAGAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173038.3-1323s21c1
Sequence:CCGGGCATGCTTCTCTACTACTTTGCTCGAGCAAAGTAGTAGAGAAGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173038.3-403s21c1
Sequence:CCGGCGTGTCAGAACTCGATCTTTCCTCGAGGAAAGATCGAGTTCTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173038.1-1276s1c1
Sequence:CCGGGCCGAACTGAAGAAACAGCTACTCGAGTAGCTGTTTCTTCAGTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks