EMAIL THIS PAGE TO A FRIEND

TBCK

TBC1 domain containing kinase

Synonyms: TBCKL
Gene ID:
Mouse(271981) TBC1 domain containing kinase
Rat(295446) TBC1 domain containing kinase
Zebrafish(791155) TBC1 domain containing kinase
chicken(422534) TBC1 domain containing kinase
domestic cat(101090610) TBC1 domain containing kinase
Horse(100064433) TBC1 domain containing kinase
dog(487892) TBC1 domain containing kinase
domestic guinea pig(100714107) TBC1 domain containing kinase
naked mole-rat(101717520) TBC1 domain containing kinase
Domestic Rabbit(100355472) TBC1 domain containing kinase
cow(528650) TBC1 domain containing kinase
sheep(101102311) TBC1 domain containing kinase
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033115 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033115 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033115 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173032 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173032 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173032 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033115 Rosetta Predictions human pricing
NM_001134513 Rosetta Predictions rat pricing
NM_173032 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022182 predicted 1088
2 SASI_Hs02_00360834 predicted 2185
3 SASI_Hs02_00360835 predicted 1014
4 SASI_Hs02_00360836 predicted 831
5 SASI_Hs01_00022183 predicted 2508
6 SASI_Hs01_00022184 predicted 2368
7 SASI_Hs01_00022186 predicted 2745
8 SASI_Hs01_00022187 predicted 941
9 SASI_Hs01_00022188 predicted 858
10 SASI_Hs02_00360837 predicted 1755
11 SASI_Hs01_00022185 predicted 348
12 SASI_Hs01_00022189 predicted 2578
13 SASI_Hs01_00022190 predicted 2149
14 SASI_Hs01_00022191 predicted 2916
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134513 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256619 predicted 646
2 SASI_Rn02_00256620 predicted 1977
3 SASI_Rn02_00256621 predicted 2103
4 SASI_Rn02_00256622 predicted 423
5 SASI_Rn02_00256623 predicted 2344
6 SASI_Rn02_00256624 predicted 650
7 SASI_Rn02_00256625 predicted 1879
8 SASI_Rn02_00256626 predicted 1279
9 SASI_Rn02_00256627 predicted 2394
10 SASI_Rn02_00256628 predicted 1904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173032 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141772 predicted 2051
2 SASI_Mm01_00141773 predicted 1958
3 SASI_Mm02_00345100 predicted 1902
4 SASI_Mm01_00141774 predicted 2165
5 SASI_Mm01_00141775 predicted 2174
6 SASI_Mm01_00141776 predicted 1143
7 SASI_Mm01_00141777 predicted 1955
8 SASI_Mm01_00141778 predicted 623
9 SASI_Mm01_00141779 predicted 2279
10 SASI_Mm01_00141780 predicted 1917
11 SASI_Mm01_00141781 predicted 2594
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033115
VALIDATED
TBCK MISSION shRNA Bacterial Glycerol Stock
TBC1 domain containing kinase
Human
21 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-1773s1c1
Sequence:CCGGGCAAGGTCTTGACTCACTTTGCTCGAGCAAAGTGAGTCAAGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-1359s1c1
Sequence:CCGGCCAGTCTAATTTACCTCATTCCTCGAGGAATGAGGTAAATTAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-1372s1c1
Sequence:CCGGCCTCATTCAAACAGCAATAATCTCGAGATTATTGCTGTTTGAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-538s1c1
Sequence:CCGGGCTGAACATTGTGAACGTAGTCTCGAGACTACGTTCACAATGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_033115.2-3070s1c1
Sequence:CCGGGCCACATAAAGCCCAAGAAATCTCGAGATTTCTTGGGCTTTATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033115.2-1482s1c1
Sequence:CCGGGCTAAAGGCTTATCCATATAACTCGAGTTATATGGATAAGCCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007077    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033115.2-2992s1c1
Sequence:CCGGGCAAGAAACTTGACTCTACATCTCGAGATGTAGAGTCAAGTTTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-2536s1c1
Sequence:CCGGCGGAATAGTGAAGACTTTATTCTCGAGAATAAAGTCTTCACTATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-2798s1c1
Sequence:CCGGCCATCCCATCTCCTCAAATATCTCGAGATATTTGAGGAGATGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-834s1c1
Sequence:CCGGGCATGGTTGTTTGGACATTATCTCGAGATAATGTCCAAACAACCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-1296s1c1
Sequence:CCGGCCAGCTAAGAAATAGATTGAACTCGAGTTCAATCTATTTCTTAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033115.3-483s21c1
Sequence:CCGGGGGCGCTTTCAAATCCTTAAACTCGAGTTTAAGGATTTGAAAGCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033115.3-524s21c1
Sequence:CCGGCTGCCAGTATGTGGATATTTCCTCGAGGAAATATCCACATACTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033115.3-1684s21c1
Sequence:CCGGGACAAATTGAAGTGGATATTCCTCGAGGAATATCCACTTCAATTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033115.3-3097s21c1
Sequence:CCGGTTTACCACACTGCCACATAAACTCGAGTTTATGTGGCAGTGTGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033115.2-1602s21c1
Sequence:GTACCGGCAAGTACGATGCAATTGATAACTCGAGTTATCAATTGCATCGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226447    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_033115.2-3037s21c1
Sequence:CCGGCAGTGAAATCTGATCATATATCTCGAGATATATGATCAGATTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_033115.2-2317s21c1
Sequence:CCGGAGAAGTTCGGCACCTTATTTCCTCGAGGAAATAAGGTGCCGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_033115.2-1482s21c1
Sequence:CCGGGCTAAAGGCTTATCCATATAACTCGAGTTATATGGATAAGCCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033115.2-1437s21c1
Sequence:CCGGGGATACAGAGTACCAACTAAACTCGAGTTTAGTTGGTACTCTGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033115.3-2955s21c1
Sequence:CCGGAGATTGTTGCATTTCCGTAAACTCGAGTTTACGGAAATGCAACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033115
VALIDATED
TBCK MISSION shRNA shRNA Plasmid DNA
TBC1 domain containing kinase
Human
21 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-1773s1c1
Sequence:CCGGGCAAGGTCTTGACTCACTTTGCTCGAGCAAAGTGAGTCAAGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-1359s1c1
Sequence:CCGGCCAGTCTAATTTACCTCATTCCTCGAGGAATGAGGTAAATTAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-1372s1c1
Sequence:CCGGCCTCATTCAAACAGCAATAATCTCGAGATTATTGCTGTTTGAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-538s1c1
Sequence:CCGGGCTGAACATTGTGAACGTAGTCTCGAGACTACGTTCACAATGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_033115.2-3070s1c1
Sequence:CCGGGCCACATAAAGCCCAAGAAATCTCGAGATTTCTTGGGCTTTATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033115.2-1482s1c1
Sequence:CCGGGCTAAAGGCTTATCCATATAACTCGAGTTATATGGATAAGCCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007077    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033115.2-2992s1c1
Sequence:CCGGGCAAGAAACTTGACTCTACATCTCGAGATGTAGAGTCAAGTTTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-2536s1c1
Sequence:CCGGCGGAATAGTGAAGACTTTATTCTCGAGAATAAAGTCTTCACTATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-2798s1c1
Sequence:CCGGCCATCCCATCTCCTCAAATATCTCGAGATATTTGAGGAGATGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-834s1c1
Sequence:CCGGGCATGGTTGTTTGGACATTATCTCGAGATAATGTCCAAACAACCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-1296s1c1
Sequence:CCGGCCAGCTAAGAAATAGATTGAACTCGAGTTCAATCTATTTCTTAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033115.3-483s21c1
Sequence:CCGGGGGCGCTTTCAAATCCTTAAACTCGAGTTTAAGGATTTGAAAGCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033115.3-524s21c1
Sequence:CCGGCTGCCAGTATGTGGATATTTCCTCGAGGAAATATCCACATACTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033115.3-1684s21c1
Sequence:CCGGGACAAATTGAAGTGGATATTCCTCGAGGAATATCCACTTCAATTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033115.3-3097s21c1
Sequence:CCGGTTTACCACACTGCCACATAAACTCGAGTTTATGTGGCAGTGTGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033115.2-1602s21c1
Sequence:GTACCGGCAAGTACGATGCAATTGATAACTCGAGTTATCAATTGCATCGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226447    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_033115.2-3037s21c1
Sequence:CCGGCAGTGAAATCTGATCATATATCTCGAGATATATGATCAGATTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_033115.2-2317s21c1
Sequence:CCGGAGAAGTTCGGCACCTTATTTCCTCGAGGAAATAAGGTGCCGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_033115.2-1482s21c1
Sequence:CCGGGCTAAAGGCTTATCCATATAACTCGAGTTATATGGATAAGCCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033115.2-1437s21c1
Sequence:CCGGGGATACAGAGTACCAACTAAACTCGAGTTTAGTTGGTACTCTGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033115.3-2955s21c1
Sequence:CCGGAGATTGTTGCATTTCCGTAAACTCGAGTTTACGGAAATGCAACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033115
VALIDATED
TBCK MISSION shRNA Lentiviral Transduction Particles
TBC1 domain containing kinase
Human
21 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-1773s1c1
Sequence:CCGGGCAAGGTCTTGACTCACTTTGCTCGAGCAAAGTGAGTCAAGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-1359s1c1
Sequence:CCGGCCAGTCTAATTTACCTCATTCCTCGAGGAATGAGGTAAATTAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-1372s1c1
Sequence:CCGGCCTCATTCAAACAGCAATAATCTCGAGATTATTGCTGTTTGAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-538s1c1
Sequence:CCGGGCTGAACATTGTGAACGTAGTCTCGAGACTACGTTCACAATGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_033115.2-3070s1c1
Sequence:CCGGGCCACATAAAGCCCAAGAAATCTCGAGATTTCTTGGGCTTTATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033115.2-1482s1c1
Sequence:CCGGGCTAAAGGCTTATCCATATAACTCGAGTTATATGGATAAGCCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007077    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033115.2-2992s1c1
Sequence:CCGGGCAAGAAACTTGACTCTACATCTCGAGATGTAGAGTCAAGTTTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-2536s1c1
Sequence:CCGGCGGAATAGTGAAGACTTTATTCTCGAGAATAAAGTCTTCACTATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-2798s1c1
Sequence:CCGGCCATCCCATCTCCTCAAATATCTCGAGATATTTGAGGAGATGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-834s1c1
Sequence:CCGGGCATGGTTGTTTGGACATTATCTCGAGATAATGTCCAAACAACCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033115.2-1296s1c1
Sequence:CCGGCCAGCTAAGAAATAGATTGAACTCGAGTTCAATCTATTTCTTAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033115.3-483s21c1
Sequence:CCGGGGGCGCTTTCAAATCCTTAAACTCGAGTTTAAGGATTTGAAAGCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033115.3-524s21c1
Sequence:CCGGCTGCCAGTATGTGGATATTTCCTCGAGGAAATATCCACATACTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033115.3-1684s21c1
Sequence:CCGGGACAAATTGAAGTGGATATTCCTCGAGGAATATCCACTTCAATTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033115.3-3097s21c1
Sequence:CCGGTTTACCACACTGCCACATAAACTCGAGTTTATGTGGCAGTGTGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033115.2-1602s21c1
Sequence:GTACCGGCAAGTACGATGCAATTGATAACTCGAGTTATCAATTGCATCGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226447    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_033115.2-3037s21c1
Sequence:CCGGCAGTGAAATCTGATCATATATCTCGAGATATATGATCAGATTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_033115.2-2317s21c1
Sequence:CCGGAGAAGTTCGGCACCTTATTTCCTCGAGGAAATAAGGTGCCGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_033115.2-1482s21c1
Sequence:CCGGGCTAAAGGCTTATCCATATAACTCGAGTTATATGGATAAGCCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033115.2-1437s21c1
Sequence:CCGGGGATACAGAGTACCAACTAAACTCGAGTTTAGTTGGTACTCTGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033115.3-2955s21c1
Sequence:CCGGAGATTGTTGCATTTCCGTAAACTCGAGTTTACGGAAATGCAACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173032
TBCK MISSION shRNA Bacterial Glycerol Stock
TBC1 domain containing kinase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173032.1-2109s1c1
Sequence:CCGGCCCTTGGTTTCTCACCATGTTCTCGAGAACATGGTGAGAAACCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173032.1-620s1c1
Sequence:CCGGGCCATATTAAACTGGCTAAATCTCGAGATTTAGCCAGTTTAATATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173032.1-1968s1c1
Sequence:CCGGCCTGTATAACTTCTTCTTGAACTCGAGTTCAAGAAGAAGTTATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173032.1-896s1c1
Sequence:CCGGGCTGTGTAGATGATACTATAACTCGAGTTATAGTATCATCTACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173032.1-1639s1c1
Sequence:CCGGCCTCCACTTATGAGAGGTTTACTCGAGTAAACCTCTCATAAGTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173032.3-838s21c1
Sequence:CCGGGTATGGTCTCTTGGGATAATTCTCGAGAATTATCCCAAGAGACCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173032.3-1588s21c1
Sequence:CCGGTATCAGCTCAACAGGATTATTCTCGAGAATAATCCTGTTGAGCTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173032.3-651s21c1
Sequence:CCGGGGATCGGAAGGGCCATATTAACTCGAGTTAATATGGCCCTTCCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173032
TBCK MISSION shRNA shRNA Plasmid DNA
TBC1 domain containing kinase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173032.1-2109s1c1
Sequence:CCGGCCCTTGGTTTCTCACCATGTTCTCGAGAACATGGTGAGAAACCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173032.1-620s1c1
Sequence:CCGGGCCATATTAAACTGGCTAAATCTCGAGATTTAGCCAGTTTAATATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173032.1-1968s1c1
Sequence:CCGGCCTGTATAACTTCTTCTTGAACTCGAGTTCAAGAAGAAGTTATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173032.1-896s1c1
Sequence:CCGGGCTGTGTAGATGATACTATAACTCGAGTTATAGTATCATCTACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173032.1-1639s1c1
Sequence:CCGGCCTCCACTTATGAGAGGTTTACTCGAGTAAACCTCTCATAAGTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173032.3-838s21c1
Sequence:CCGGGTATGGTCTCTTGGGATAATTCTCGAGAATTATCCCAAGAGACCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173032.3-1588s21c1
Sequence:CCGGTATCAGCTCAACAGGATTATTCTCGAGAATAATCCTGTTGAGCTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173032.3-651s21c1
Sequence:CCGGGGATCGGAAGGGCCATATTAACTCGAGTTAATATGGCCCTTCCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173032
TBCK MISSION shRNA Lentiviral Transduction Particles
TBC1 domain containing kinase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173032.1-2109s1c1
Sequence:CCGGCCCTTGGTTTCTCACCATGTTCTCGAGAACATGGTGAGAAACCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173032.1-620s1c1
Sequence:CCGGGCCATATTAAACTGGCTAAATCTCGAGATTTAGCCAGTTTAATATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173032.1-1968s1c1
Sequence:CCGGCCTGTATAACTTCTTCTTGAACTCGAGTTCAAGAAGAAGTTATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173032.1-896s1c1
Sequence:CCGGGCTGTGTAGATGATACTATAACTCGAGTTATAGTATCATCTACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173032.1-1639s1c1
Sequence:CCGGCCTCCACTTATGAGAGGTTTACTCGAGTAAACCTCTCATAAGTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173032.3-838s21c1
Sequence:CCGGGTATGGTCTCTTGGGATAATTCTCGAGAATTATCCCAAGAGACCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173032.3-1588s21c1
Sequence:CCGGTATCAGCTCAACAGGATTATTCTCGAGAATAATCCTGTTGAGCTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173032.3-651s21c1
Sequence:CCGGGGATCGGAAGGGCCATATTAACTCGAGTTAATATGGCCCTTCCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks