EMAIL THIS PAGE TO A FRIEND

TBK1

TANK-binding kinase 1

Synonyms: NAK T2K
UniProtKB ID: Q9UHD2, A8K4S4, Q8IYV3, Q9NUJ5
Gene ID:
Human(29110) Summary: The NF-kappa-B (NFKB) complex of proteins is inhibited by I-kappa-B (IKB) proteins, which inactivate NFKB by trapping it in the cytoplasm. Phosphorylation of serine residues on the IKB proteins by IKB kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation and nuclear translocation of the NFKB complex. The protein encoded by this gene is similar to IKB kinases and can mediate NFKB activation in response to certain growth factors. [provided by RefSeq, Oct 2010]
Mouse(56480) TANK-binding kinase 1
Rat(299827) TANK-binding kinase 1
Zebrafish(692289) TANK-binding kinase 1
chicken(417825) TANK-binding kinase 1
dog(481145) TANK-binding kinase 1
domestic cat(101091955) TANK-binding kinase 1
Horse(100051650) TANK-binding kinase 1
cow(533141) TANK-binding kinase 1
sheep(101110830) TANK-binding kinase 1
Domestic Rabbit(100358771) TANK-binding kinase 1
naked mole-rat(101713766) TANK-binding kinase 1
domestic guinea pig(100731956) TANK-binding kinase 1
122 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302395 ANTI-MOUSE TBK1 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
PRS2351 Anti-NAK antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunocytochemistry, western blot pricing
SAB1305587 ANTI-PHOSPHO-TBK(S172) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
dot blot, ELISA pricing
SAB1306394 ANTI-TBK (S172) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2108725 Anti-TBK1 affinity isolated antibody bovine, horse, human, mouse, bovine, rabbit, canine, guinea pig, zebrafish, rat
western blot pricing
T6327 Anti-TBK1 (536-550) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2102377 Anti-TBK1 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, horse, human, rabbit, rat
western blot pricing
SAB2104892 Anti-TBK1 antibody produced in rabbit affinity isolated antibody human, horse, rabbit, mouse, rat, guinea pig
western blot pricing
HPA045797 Anti-TBK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1410579 Anti-TBK1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA060211 Anti-TBK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
N2661 Monoclonal Anti-NAK (NFκB-Activating Kinase) antibody produced in mouse ~2.5 mg/mL, clone NAK369, purified immunoglobulin, buffered aqueous solution chicken, human, rat
ELISA, microarray, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0439 AQUA Peptide EPLNTIGLIYE[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013254 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013254 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013254 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019786 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019786 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019786 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034511 MISSION® esiRNA esiRNA human TBK1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013254 siRNAs that have been validated in the lab human pricing
NM_001106786 Rosetta Predictions rat pricing
NM_019786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013254 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062065 validated 970
1 SASI_Hs01_00062066 validated 2194
1 SASI_Hs01_00062067 validated 1725
2 SASI_Hs02_00344468 predicted 2334
3 SASI_Hs02_00344469 predicted 1039
4 SASI_Hs01_00062068 predicted 2089
5 SASI_Hs01_00062069 predicted 1114
6 SASI_Hs02_00344470 predicted 407
7 SASI_Hs02_00344471 predicted 1846
8 SASI_Hs01_00062070 predicted 445
9 SASI_Hs01_00062071 predicted 436
10 SASI_Hs01_00062072 predicted 2318
11 SASI_Hs01_00062073 predicted 432
12 SASI_Hs01_00062074 predicted 1833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106786 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222388 predicted 1095
2 SASI_Rn02_00222389 predicted 1755
3 SASI_Rn02_00222390 predicted 1004
4 SASI_Rn02_00222391 predicted 480
5 SASI_Rn02_00222392 predicted 2126
6 SASI_Rn02_00222393 predicted 1888
7 SASI_Rn02_00222394 predicted 473
8 SASI_Rn02_00222395 predicted 1125
9 SASI_Rn02_00222396 predicted 826
10 SASI_Rn02_00222397 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324992 predicted 1016
2 SASI_Mm01_00094353 predicted 2147
3 SASI_Mm01_00094354 predicted 575
4 SASI_Mm02_00324993 predicted 1858
5 SASI_Mm01_00094356 predicted 207
6 SASI_Mm01_00094357 predicted 493
7 SASI_Mm02_00324994 predicted 873
8 SASI_Mm01_00094359 predicted 1054
9 SASI_Mm02_00324995 predicted 654
10 SASI_Mm01_00094360 predicted 471
11 SASI_Mm01_00094352 predicted 276
12 SASI_Mm01_00094355 predicted 1114
13 SASI_Mm01_00094358 predicted 1915
14 SASI_Mm01_00094361 predicted 460
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013254
VALIDATED
TBK1 MISSION shRNA Bacterial Glycerol Stock
TANK-binding kinase 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013254.2-1622s21c1
Sequence:GTACCGGGGATATCGACAGCAGATTATCCTCGAGGATAATCTGCTGTCGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_013254.2-1536s21c1
Sequence:CCGGGCGGCAGAGTTAGGTGAAATTCTCGAGAATTTCACCTAACTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_013254.2-2357s21c1
Sequence:CCGGATTTGATGTGGTCGTGTAAATCTCGAGATTTACACGACCACATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_013254.2-1773s21c1
Sequence:CCGGGCAGAACGTAGATTAGCTTATCTCGAGATAAGCTAATCTACGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013254.2-449s21c1
Sequence:CCGGTGGTATAGTGCACCGTGATATCTCGAGATATCACGGTGCACTATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_013254.2-1212s21c1
Sequence:CCGGCGGGAACCTCTGAATACCATACTCGAGTATGGTATTCAGAGGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013254.x-1773s1c1
Sequence:CCGGGCAGAACGTAGATTAGCTTATCTCGAGATAAGCTAATCTACGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_013254.x-1536s1c1
Sequence:CCGGGCGGCAGAGTTAGGTGAAATTCTCGAGAATTTCACCTAACTCTGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013254.x-474s1c1
Sequence:CCGGCCAGGAAATATCATGCGTGTTCTCGAGAACACGCATGATATTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_013254.x-1212s1c1
Sequence:CCGGCGGGAACCTCTGAATACCATACTCGAGTATGGTATTCAGAGGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013254.2-851s1c1
Sequence:CCGGGCCTGTTTCTTGCAGTCTTTCCTCGAGGAAAGACTGCAAGAAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013254.2-543s1c1
Sequence:CCGGGCTAGAGAATTAGAAGATGATCTCGAGATCATCTTCTAATTCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013254
VALIDATED
TBK1 MISSION shRNA shRNA Plasmid DNA
TANK-binding kinase 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013254.2-1622s21c1
Sequence:GTACCGGGGATATCGACAGCAGATTATCCTCGAGGATAATCTGCTGTCGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_013254.2-1536s21c1
Sequence:CCGGGCGGCAGAGTTAGGTGAAATTCTCGAGAATTTCACCTAACTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_013254.2-2357s21c1
Sequence:CCGGATTTGATGTGGTCGTGTAAATCTCGAGATTTACACGACCACATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_013254.2-1773s21c1
Sequence:CCGGGCAGAACGTAGATTAGCTTATCTCGAGATAAGCTAATCTACGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013254.2-449s21c1
Sequence:CCGGTGGTATAGTGCACCGTGATATCTCGAGATATCACGGTGCACTATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_013254.2-1212s21c1
Sequence:CCGGCGGGAACCTCTGAATACCATACTCGAGTATGGTATTCAGAGGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013254.x-1773s1c1
Sequence:CCGGGCAGAACGTAGATTAGCTTATCTCGAGATAAGCTAATCTACGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_013254.x-1536s1c1
Sequence:CCGGGCGGCAGAGTTAGGTGAAATTCTCGAGAATTTCACCTAACTCTGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013254.x-474s1c1
Sequence:CCGGCCAGGAAATATCATGCGTGTTCTCGAGAACACGCATGATATTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_013254.x-1212s1c1
Sequence:CCGGCGGGAACCTCTGAATACCATACTCGAGTATGGTATTCAGAGGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013254.2-851s1c1
Sequence:CCGGGCCTGTTTCTTGCAGTCTTTCCTCGAGGAAAGACTGCAAGAAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013254.2-543s1c1
Sequence:CCGGGCTAGAGAATTAGAAGATGATCTCGAGATCATCTTCTAATTCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013254
VALIDATED
TBK1 MISSION shRNA Lentiviral Transduction Particles
TANK-binding kinase 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013254.2-1622s21c1
Sequence:GTACCGGGGATATCGACAGCAGATTATCCTCGAGGATAATCTGCTGTCGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_013254.2-1536s21c1
Sequence:CCGGGCGGCAGAGTTAGGTGAAATTCTCGAGAATTTCACCTAACTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_013254.2-2357s21c1
Sequence:CCGGATTTGATGTGGTCGTGTAAATCTCGAGATTTACACGACCACATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_013254.2-1773s21c1
Sequence:CCGGGCAGAACGTAGATTAGCTTATCTCGAGATAAGCTAATCTACGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013254.2-449s21c1
Sequence:CCGGTGGTATAGTGCACCGTGATATCTCGAGATATCACGGTGCACTATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_013254.2-1212s21c1
Sequence:CCGGCGGGAACCTCTGAATACCATACTCGAGTATGGTATTCAGAGGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013254.x-1773s1c1
Sequence:CCGGGCAGAACGTAGATTAGCTTATCTCGAGATAAGCTAATCTACGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_013254.x-1536s1c1
Sequence:CCGGGCGGCAGAGTTAGGTGAAATTCTCGAGAATTTCACCTAACTCTGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013254.x-474s1c1
Sequence:CCGGCCAGGAAATATCATGCGTGTTCTCGAGAACACGCATGATATTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_013254.x-1212s1c1
Sequence:CCGGCGGGAACCTCTGAATACCATACTCGAGTATGGTATTCAGAGGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013254.2-851s1c1
Sequence:CCGGGCCTGTTTCTTGCAGTCTTTCCTCGAGGAAAGACTGCAAGAAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013254.2-543s1c1
Sequence:CCGGGCTAGAGAATTAGAAGATGATCTCGAGATCATCTTCTAATTCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019786
VALIDATED
TBK1 MISSION shRNA Bacterial Glycerol Stock
TANK-binding kinase 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.4-1112s21c1
Sequence:CCGGACATGACGGCGCATAAGATTTCTCGAGAAATCTTATGCGCCGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.3-1115s21c3
Sequence:CCGGTTCCATGAACTGGTCTATAAACTCGAGTTTATAGACCAGTTCATGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.4-1871s21c1
Sequence:CCGGCAGAACGCAGACTAGCTTATACTCGAGTATAAGCTAGTCTGCGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.4-2739s21c1
Sequence:CCGGGGAACAGAACCGCGGTTTAACCTCGAGGTTAAACCGCGGTTCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.3-2221s21c1
Sequence:CCGGGCTGGCCGAGAACAATCATATCTCGAGATATGATTGTTCTCGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.3-2691s21c1
Sequence:CCGGGGGAACAGAACCGCGGTTTAACTCGAGTTAAACCGCGGTTCTGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.3-1825s21c2
Sequence:CCGGAGAACGCAGACTAGCTTATAACTCGAGTTATAAGCTAGTCTGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.3-434s21c3
Sequence:CCGGCCAGAATCAGAATTTCTCATTCTCGAGAATGAGAAATTCTGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019786.2-435s1c1
Sequence:CCGGCCAGAATCAGAATTTCTCATTCTCGAGAATGAGAAATTCTGATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019786.2-1595s1c1
Sequence:CCGGGCTGGGTGAGATTTCAGACATCTCGAGATGTCTGAAATCTCACCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019786.2-2222s1c1
Sequence:CCGGGCTGGCCGAGAACAATCATATCTCGAGATATGATTGTTCTCGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019786.2-792s1c1
Sequence:CCGGCCTCGGAGGAACAAAGAAGTACTCGAGTACTTCTTTGTTCCTCCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019786.2-1944s1c1
Sequence:CCGGGCGTTTAAAGATAAGTCGGAACTCGAGTTCCGACTTATCTTTAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019786
VALIDATED
TBK1 MISSION shRNA shRNA Plasmid DNA
TANK-binding kinase 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.4-1112s21c1
Sequence:CCGGACATGACGGCGCATAAGATTTCTCGAGAAATCTTATGCGCCGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.3-1115s21c3
Sequence:CCGGTTCCATGAACTGGTCTATAAACTCGAGTTTATAGACCAGTTCATGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.4-1871s21c1
Sequence:CCGGCAGAACGCAGACTAGCTTATACTCGAGTATAAGCTAGTCTGCGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.4-2739s21c1
Sequence:CCGGGGAACAGAACCGCGGTTTAACCTCGAGGTTAAACCGCGGTTCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.3-2221s21c1
Sequence:CCGGGCTGGCCGAGAACAATCATATCTCGAGATATGATTGTTCTCGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.3-2691s21c1
Sequence:CCGGGGGAACAGAACCGCGGTTTAACTCGAGTTAAACCGCGGTTCTGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.3-1825s21c2
Sequence:CCGGAGAACGCAGACTAGCTTATAACTCGAGTTATAAGCTAGTCTGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.3-434s21c3
Sequence:CCGGCCAGAATCAGAATTTCTCATTCTCGAGAATGAGAAATTCTGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019786.2-435s1c1
Sequence:CCGGCCAGAATCAGAATTTCTCATTCTCGAGAATGAGAAATTCTGATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019786.2-1595s1c1
Sequence:CCGGGCTGGGTGAGATTTCAGACATCTCGAGATGTCTGAAATCTCACCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019786.2-2222s1c1
Sequence:CCGGGCTGGCCGAGAACAATCATATCTCGAGATATGATTGTTCTCGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019786.2-792s1c1
Sequence:CCGGCCTCGGAGGAACAAAGAAGTACTCGAGTACTTCTTTGTTCCTCCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019786.2-1944s1c1
Sequence:CCGGGCGTTTAAAGATAAGTCGGAACTCGAGTTCCGACTTATCTTTAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019786
VALIDATED
TBK1 MISSION shRNA Lentiviral Transduction Particles
TANK-binding kinase 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.4-1112s21c1
Sequence:CCGGACATGACGGCGCATAAGATTTCTCGAGAAATCTTATGCGCCGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.3-1115s21c3
Sequence:CCGGTTCCATGAACTGGTCTATAAACTCGAGTTTATAGACCAGTTCATGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.4-1871s21c1
Sequence:CCGGCAGAACGCAGACTAGCTTATACTCGAGTATAAGCTAGTCTGCGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.4-2739s21c1
Sequence:CCGGGGAACAGAACCGCGGTTTAACCTCGAGGTTAAACCGCGGTTCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.3-2221s21c1
Sequence:CCGGGCTGGCCGAGAACAATCATATCTCGAGATATGATTGTTCTCGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.3-2691s21c1
Sequence:CCGGGGGAACAGAACCGCGGTTTAACTCGAGTTAAACCGCGGTTCTGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.3-1825s21c2
Sequence:CCGGAGAACGCAGACTAGCTTATAACTCGAGTTATAAGCTAGTCTGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019786.3-434s21c3
Sequence:CCGGCCAGAATCAGAATTTCTCATTCTCGAGAATGAGAAATTCTGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019786.2-435s1c1
Sequence:CCGGCCAGAATCAGAATTTCTCATTCTCGAGAATGAGAAATTCTGATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019786.2-1595s1c1
Sequence:CCGGGCTGGGTGAGATTTCAGACATCTCGAGATGTCTGAAATCTCACCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019786.2-2222s1c1
Sequence:CCGGGCTGGCCGAGAACAATCATATCTCGAGATATGATTGTTCTCGGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019786.2-792s1c1
Sequence:CCGGCCTCGGAGGAACAAAGAAGTACTCGAGTACTTCTTTGTTCCTCCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019786.2-1944s1c1
Sequence:CCGGGCGTTTAAAGATAAGTCGGAACTCGAGTTCCGACTTATCTTTAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks