EMAIL THIS PAGE TO A FRIEND

TBKBP1

TBK1 binding protein 1

Synonyms: ProSAPiP2 SINTBAD
UniProtKB ID: A7MCY6, B2RZG6, O94873, Q14DW3
Gene ID:
Human(9755) Summary: TBKBP1 is an adaptor protein that binds to TBK1 (MIM 604834) and is part of the interaction network in the TNF (MIM 191160)/NFKB (see MIM 164011) pathway (Bouwmeester et al., 2004 [PubMed 14743216]
Mouse(73174) TBK1 binding protein 1
Rat(266764) TBK1 binding protein 1
domestic guinea pig(100723250) TBK1 binding protein 1
naked mole-rat(101705972) TBK1 binding protein 1
cow(785603) TBK1 binding protein 1
sheep(101122370) TBK1 binding protein 1
Zebrafish(559568) TBK1 binding protein 1
chicken(430679) TBK1 binding protein 1
dog(491043) TBK1 binding protein 1
domestic cat(101097851) TBK1 binding protein 1
144 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198100 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198100 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198100 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014726 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014726 Rosetta Predictions human pricing
NM_172021 Rosetta Predictions rat pricing
NM_198100 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122778 predicted 975
2 SASI_Hs01_00122779 predicted 1173
3 SASI_Hs02_00346170 predicted 1224
4 SASI_Hs01_00122781 predicted 1061
5 SASI_Hs01_00122782 predicted 2636
6 SASI_Hs01_00122783 predicted 2552
7 SASI_Hs01_00122784 predicted 2855
8 SASI_Hs01_00122785 predicted 1177
9 SASI_Hs01_00122786 predicted 1421
10 SASI_Hs01_00122787 predicted 2821
11 SASI_Hs01_00122780 predicted 2982
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094511 predicted 601
2 SASI_Rn01_00094512 predicted 524
3 SASI_Rn01_00094513 predicted 1097
4 SASI_Rn01_00094514 predicted 1824
5 SASI_Rn01_00094515 predicted 1582
6 SASI_Rn01_00094516 predicted 332
7 SASI_Rn01_00094517 predicted 2060
8 SASI_Rn01_00094518 predicted 701
9 SASI_Rn02_00269109 predicted 2202
10 SASI_Rn01_00094520 predicted 1115
11 SASI_Rn01_00094519 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198100 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082085 predicted 704
2 SASI_Mm01_00082086 predicted 2065
3 SASI_Mm02_00350822 predicted 2220
4 SASI_Mm01_00082087 predicted 2092
5 SASI_Mm01_00082088 predicted 1964
6 SASI_Mm01_00082090 predicted 1818
7 SASI_Mm01_00082091 predicted 341
8 SASI_Mm01_00082092 predicted 1651
9 SASI_Mm01_00082093 predicted 2141
10 SASI_Mm01_00082094 predicted 450
11 SASI_Mm01_00082089 predicted 2305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198100
VALIDATED
TBKBP1 MISSION shRNA Bacterial Glycerol Stock
TBK1 binding protein 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198100.1-387s1c1
Sequence:CCGGCTTCCCTCTGTATGAACTCAACTCGAGTTGAGTTCATACAGAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198100.1-1867s1c1
Sequence:CCGGGATGCTCTCATCAAACACATACTCGAGTATGTGTTTGATGAGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198100.1-1896s1c1
Sequence:CCGGCCTTGAGAACAGCAAGATCTACTCGAGTAGATCTTGCTGTTCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198100.1-2293s1c1
Sequence:CCGGCCTTCCCAAATGTCTGTCTTTCTCGAGAAAGACAGACATTTGGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174826    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198100.1-2815s1c1
Sequence:CCGGGCTGTGGAGATTAATTTCAAACTCGAGTTTGAAATTAATCTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198100.1-330s1c1
Sequence:CCGGCCTCAAAGTCTATGAGATCAACTCGAGTTGATCTCATAGACTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198100
VALIDATED
TBKBP1 MISSION shRNA shRNA Plasmid DNA
TBK1 binding protein 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198100.1-387s1c1
Sequence:CCGGCTTCCCTCTGTATGAACTCAACTCGAGTTGAGTTCATACAGAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198100.1-1867s1c1
Sequence:CCGGGATGCTCTCATCAAACACATACTCGAGTATGTGTTTGATGAGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198100.1-1896s1c1
Sequence:CCGGCCTTGAGAACAGCAAGATCTACTCGAGTAGATCTTGCTGTTCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198100.1-2293s1c1
Sequence:CCGGCCTTCCCAAATGTCTGTCTTTCTCGAGAAAGACAGACATTTGGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174826    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198100.1-2815s1c1
Sequence:CCGGGCTGTGGAGATTAATTTCAAACTCGAGTTTGAAATTAATCTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198100.1-330s1c1
Sequence:CCGGCCTCAAAGTCTATGAGATCAACTCGAGTTGATCTCATAGACTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198100
VALIDATED
TBKBP1 MISSION shRNA Lentiviral Transduction Particles
TBK1 binding protein 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198100.1-387s1c1
Sequence:CCGGCTTCCCTCTGTATGAACTCAACTCGAGTTGAGTTCATACAGAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198100.1-1867s1c1
Sequence:CCGGGATGCTCTCATCAAACACATACTCGAGTATGTGTTTGATGAGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198100.1-1896s1c1
Sequence:CCGGCCTTGAGAACAGCAAGATCTACTCGAGTAGATCTTGCTGTTCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198100.1-2293s1c1
Sequence:CCGGCCTTCCCAAATGTCTGTCTTTCTCGAGAAAGACAGACATTTGGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174826    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198100.1-2815s1c1
Sequence:CCGGGCTGTGGAGATTAATTTCAAACTCGAGTTTGAAATTAATCTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198100.1-330s1c1
Sequence:CCGGCCTCAAAGTCTATGAGATCAACTCGAGTTGATCTCATAGACTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014726
TBKBP1 MISSION shRNA Bacterial Glycerol Stock
TBK1 binding protein 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014726.1-1053s1c1
Sequence:CCGGCCTCAAAGTCTACGAGATCAACTCGAGTTGATCTCGTAGACTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014726.1-2982s1c1
Sequence:CCGGCCTCTGCCTTTCTGTTCTTAACTCGAGTTAAGAACAGAAAGGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014726.1-1201s1c1
Sequence:CCGGCAGAAGAACAAGGAGCAGGAACTCGAGTTCCTGCTCCTTGTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014726.1-1797s1c1
Sequence:CCGGGAGAATCTTGAGGACTCTGTTCTCGAGAACAGAGTCCTCAAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014726.1-3639s1c1
Sequence:CCGGGCTGTGGAGATCAACTTCAAACTCGAGTTTGAAGTTGATCTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014726
TBKBP1 MISSION shRNA shRNA Plasmid DNA
TBK1 binding protein 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014726.1-1053s1c1
Sequence:CCGGCCTCAAAGTCTACGAGATCAACTCGAGTTGATCTCGTAGACTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014726.1-2982s1c1
Sequence:CCGGCCTCTGCCTTTCTGTTCTTAACTCGAGTTAAGAACAGAAAGGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014726.1-1201s1c1
Sequence:CCGGCAGAAGAACAAGGAGCAGGAACTCGAGTTCCTGCTCCTTGTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014726.1-1797s1c1
Sequence:CCGGGAGAATCTTGAGGACTCTGTTCTCGAGAACAGAGTCCTCAAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014726.1-3639s1c1
Sequence:CCGGGCTGTGGAGATCAACTTCAAACTCGAGTTTGAAGTTGATCTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014726
TBKBP1 MISSION shRNA Lentiviral Transduction Particles
TBK1 binding protein 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014726.1-1053s1c1
Sequence:CCGGCCTCAAAGTCTACGAGATCAACTCGAGTTGATCTCGTAGACTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014726.1-2982s1c1
Sequence:CCGGCCTCTGCCTTTCTGTTCTTAACTCGAGTTAAGAACAGAAAGGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014726.1-1201s1c1
Sequence:CCGGCAGAAGAACAAGGAGCAGGAACTCGAGTTCCTGCTCCTTGTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014726.1-1797s1c1
Sequence:CCGGGAGAATCTTGAGGACTCTGTTCTCGAGAACAGAGTCCTCAAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014726.1-3639s1c1
Sequence:CCGGGCTGTGGAGATCAACTTCAAACTCGAGTTTGAAGTTGATCTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks