EMAIL THIS PAGE TO A FRIEND

TBL1X

transducin (beta)-like 1X-linked

Synonyms: EBI SMAP55 TBL1
UniProtKB ID: O60907, A8K044, A8K4J7, Q86UY2
Gene ID:
Human(6907) Summary: The protein encoded by this gene has sequence similarity with members of the WD40 repeat-containing protein family. The WD40 group is a large family of proteins, which appear to have a regulatory function. It is believed that the WD40 repeats mediate protein-protein interactions and members of the family are involved in signal transduction, RNA processing, gene regulation, vesicular trafficking, cytoskeletal assembly and may play a role in the control of cytotypic differentiation. This encoded protein is found as a subunit in corepressor SMRT (silencing mediator for retinoid and thyroid receptors) complex along with histone deacetylase 3 protein. This gene is located adjacent to the ocular albinism gene and it is thought to be involved in the pathogenesis of the ocular albinism with late-onset sensorineural deafness phenotype. Four transcript variants encoding two different isoforms have been found for this gene. This gene is highly similar to the Y chromosome TBL1Y gene. [provided by RefSeq, Nov 2008]
Mouse(21372) transducin (beta)-like 1 X-linked
Rat(302711) transducin (beta)-like 1 X-linked
Zebrafish(560294) transducin (beta)-like 1X-linked
dog(611017) transducin (beta)-like 1X-linked
Horse(100054115) transducin (beta)-like 1X-linked
domestic cat(101084773) transducin (beta)-like 1X-linked
chicken(426045) transducin (beta)-like 1X-linked
cow(515972) transducin (beta)-like 1X-linked
sheep(101119116) transducin (beta)-like 1X-linked
naked mole-rat(101721940) transducin (beta)-like 1X-linked
domestic guinea pig(100734681) transducin (beta)-like 1X-linked
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005647 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005647 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005647 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020601 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020601 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020601 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU063031 MISSION® esiRNA esiRNA targeting mouse Tbl1x (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005647 Rosetta Predictions human pricing
NM_001106964 Rosetta Predictions rat pricing
NM_020601 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144789 predicted 2471
2 SASI_Hs01_00144790 predicted 2178
3 SASI_Hs01_00144791 predicted 2174
4 SASI_Hs01_00144792 predicted 2000
5 SASI_Hs01_00144793 predicted 1529
6 SASI_Hs01_00144794 predicted 2164
7 SASI_Hs01_00144795 predicted 2164
8 SASI_Hs01_00144797 predicted 2406
9 SASI_Hs01_00144798 predicted 1978
10 SASI_Hs02_00340005 predicted 2113
11 SASI_Hs01_00144796 predicted 1646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224146 predicted 915
2 SASI_Rn02_00224147 predicted 1323
3 SASI_Rn02_00224148 predicted 1747
4 SASI_Rn02_00224149 predicted 943
5 SASI_Rn02_00224150 predicted 1113
6 SASI_Rn02_00224151 predicted 1899
7 SASI_Rn02_00224152 predicted 1114
8 SASI_Rn02_00224153 predicted 1900
9 SASI_Rn02_00224154 predicted 1377
10 SASI_Rn02_00224155 predicted 1640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058655 predicted 1522
2 SASI_Mm01_00058656 predicted 1295
3 SASI_Mm01_00058657 predicted 881
4 SASI_Mm01_00058658 predicted 1591
5 SASI_Mm01_00058659 predicted 1085
6 SASI_Mm01_00058660 predicted 862
7 SASI_Mm01_00058661 predicted 1712
8 SASI_Mm01_00058662 predicted 1867
9 SASI_Mm01_00058664 predicted 1865
10 SASI_Mm02_00325707 predicted 904
11 SASI_Mm01_00058663 predicted 1084
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005647
VALIDATED
TBL1X MISSION shRNA Bacterial Glycerol Stock
transducin (beta)-like 1X-linked
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005647.2-2218s1c1
Sequence:CCGGCTTCGACAAGTGCGTCCATATCTCGAGATATGGACGCACTTGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005647.2-1534s1c1
Sequence:CCGGGAATACCAATGGAACACTCTTCTCGAGAAGAGTGTTCCATTGGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005647.2-3289s1c1
Sequence:CCGGGCGTAGTAAGTGCTTTATGTACTCGAGTACATAAAGCACTTACTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005647.2-710s1c1
Sequence:CCGGCAGTCAGTCTTGCACCACTTTCTCGAGAAAGTGGTGCAAGACTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005647.2-986s1c1
Sequence:CCGGGAGATCAGTATCAACGAGGATCTCGAGATCCTCGTTGATACTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005647.3-2059s21c1
Sequence:CCGGCTTCGACAAGTGCGTCCATATCTCGAGATATGGACGCACTTGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005647.3-827s21c1
Sequence:CCGGGAGATCAGTATCAACGAGGATCTCGAGATCCTCGTTGATACTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005647.3-1375s21c1
Sequence:CCGGGAATACCAATGGAACACTCTTCTCGAGAAGAGTGTTCCATTGGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005647.3-1830s21c1
Sequence:CCGGATGATCTTCAGGCTCACAATACTCGAGTATTGTGAGCCTGAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005647.3-3129s21c1
Sequence:CCGGGCGTAGTAAGTGCTTTATGTACTCGAGTACATAAAGCACTTACTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005647
VALIDATED
TBL1X MISSION shRNA shRNA Plasmid DNA
transducin (beta)-like 1X-linked
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005647.2-2218s1c1
Sequence:CCGGCTTCGACAAGTGCGTCCATATCTCGAGATATGGACGCACTTGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005647.2-1534s1c1
Sequence:CCGGGAATACCAATGGAACACTCTTCTCGAGAAGAGTGTTCCATTGGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005647.2-3289s1c1
Sequence:CCGGGCGTAGTAAGTGCTTTATGTACTCGAGTACATAAAGCACTTACTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005647.2-710s1c1
Sequence:CCGGCAGTCAGTCTTGCACCACTTTCTCGAGAAAGTGGTGCAAGACTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005647.2-986s1c1
Sequence:CCGGGAGATCAGTATCAACGAGGATCTCGAGATCCTCGTTGATACTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005647.3-2059s21c1
Sequence:CCGGCTTCGACAAGTGCGTCCATATCTCGAGATATGGACGCACTTGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005647.3-827s21c1
Sequence:CCGGGAGATCAGTATCAACGAGGATCTCGAGATCCTCGTTGATACTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005647.3-1375s21c1
Sequence:CCGGGAATACCAATGGAACACTCTTCTCGAGAAGAGTGTTCCATTGGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005647.3-1830s21c1
Sequence:CCGGATGATCTTCAGGCTCACAATACTCGAGTATTGTGAGCCTGAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005647.3-3129s21c1
Sequence:CCGGGCGTAGTAAGTGCTTTATGTACTCGAGTACATAAAGCACTTACTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005647
VALIDATED
TBL1X MISSION shRNA Lentiviral Transduction Particles
transducin (beta)-like 1X-linked
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005647.2-2218s1c1
Sequence:CCGGCTTCGACAAGTGCGTCCATATCTCGAGATATGGACGCACTTGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005647.2-1534s1c1
Sequence:CCGGGAATACCAATGGAACACTCTTCTCGAGAAGAGTGTTCCATTGGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005647.2-3289s1c1
Sequence:CCGGGCGTAGTAAGTGCTTTATGTACTCGAGTACATAAAGCACTTACTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005647.2-710s1c1
Sequence:CCGGCAGTCAGTCTTGCACCACTTTCTCGAGAAAGTGGTGCAAGACTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005647.2-986s1c1
Sequence:CCGGGAGATCAGTATCAACGAGGATCTCGAGATCCTCGTTGATACTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005647.3-2059s21c1
Sequence:CCGGCTTCGACAAGTGCGTCCATATCTCGAGATATGGACGCACTTGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005647.3-827s21c1
Sequence:CCGGGAGATCAGTATCAACGAGGATCTCGAGATCCTCGTTGATACTGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005647.3-1375s21c1
Sequence:CCGGGAATACCAATGGAACACTCTTCTCGAGAAGAGTGTTCCATTGGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005647.3-1830s21c1
Sequence:CCGGATGATCTTCAGGCTCACAATACTCGAGTATTGTGAGCCTGAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005647.3-3129s21c1
Sequence:CCGGGCGTAGTAAGTGCTTTATGTACTCGAGTACATAAAGCACTTACTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020601
VALIDATED
TBL1X MISSION shRNA Bacterial Glycerol Stock
transducin (beta)-like 1X-linked
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020601.1-1988s1c1
Sequence:CCGGGCATGGTTGTATCACAGGAATCTCGAGATTCCTGTGATACAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020601.1-1459s1c1
Sequence:CCGGCCGAACTCCAACATCATGTTACTCGAGTAACATGATGTTGGAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020601.1-890s1c1
Sequence:CCGGGACATGATGTTCCCAGTAATACTCGAGTATTACTGGGAACATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020601.1-269s1c1
Sequence:CCGGCCTTCACGTTTGGGATCGAAACTCGAGTTTCGATCCCAAACGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020601.1-811s1c1
Sequence:CCGGGCGAGGATATGGAACCTTAATCTCGAGATTAAGGTTCCATATCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020601.2-810s21c1
Sequence:CCGGGCGAGGATATGGAACCTTAATCTCGAGATTAAGGTTCCATATCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020601.2-889s21c1
Sequence:CCGGGACATGATGTTCCCAGTAATACTCGAGTATTACTGGGAACATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020601.2-1987s21c1
Sequence:CCGGGCATGGTTGTATCACAGGAATCTCGAGATTCCTGTGATACAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020601.2-1458s21c1
Sequence:CCGGCCGAACTCCAACATCATGTTACTCGAGTAACATGATGTTGGAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020601
VALIDATED
TBL1X MISSION shRNA shRNA Plasmid DNA
transducin (beta)-like 1X-linked
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020601.1-1988s1c1
Sequence:CCGGGCATGGTTGTATCACAGGAATCTCGAGATTCCTGTGATACAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020601.1-1459s1c1
Sequence:CCGGCCGAACTCCAACATCATGTTACTCGAGTAACATGATGTTGGAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020601.1-890s1c1
Sequence:CCGGGACATGATGTTCCCAGTAATACTCGAGTATTACTGGGAACATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020601.1-269s1c1
Sequence:CCGGCCTTCACGTTTGGGATCGAAACTCGAGTTTCGATCCCAAACGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020601.1-811s1c1
Sequence:CCGGGCGAGGATATGGAACCTTAATCTCGAGATTAAGGTTCCATATCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020601.2-810s21c1
Sequence:CCGGGCGAGGATATGGAACCTTAATCTCGAGATTAAGGTTCCATATCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020601.2-889s21c1
Sequence:CCGGGACATGATGTTCCCAGTAATACTCGAGTATTACTGGGAACATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020601.2-1987s21c1
Sequence:CCGGGCATGGTTGTATCACAGGAATCTCGAGATTCCTGTGATACAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020601.2-1458s21c1
Sequence:CCGGCCGAACTCCAACATCATGTTACTCGAGTAACATGATGTTGGAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020601
VALIDATED
TBL1X MISSION shRNA Lentiviral Transduction Particles
transducin (beta)-like 1X-linked
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020601.1-1988s1c1
Sequence:CCGGGCATGGTTGTATCACAGGAATCTCGAGATTCCTGTGATACAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020601.1-1459s1c1
Sequence:CCGGCCGAACTCCAACATCATGTTACTCGAGTAACATGATGTTGGAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020601.1-890s1c1
Sequence:CCGGGACATGATGTTCCCAGTAATACTCGAGTATTACTGGGAACATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020601.1-269s1c1
Sequence:CCGGCCTTCACGTTTGGGATCGAAACTCGAGTTTCGATCCCAAACGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_020601.1-811s1c1
Sequence:CCGGGCGAGGATATGGAACCTTAATCTCGAGATTAAGGTTCCATATCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020601.2-810s21c1
Sequence:CCGGGCGAGGATATGGAACCTTAATCTCGAGATTAAGGTTCCATATCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020601.2-889s21c1
Sequence:CCGGGACATGATGTTCCCAGTAATACTCGAGTATTACTGGGAACATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020601.2-1987s21c1
Sequence:CCGGGCATGGTTGTATCACAGGAATCTCGAGATTCCTGTGATACAACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020601.2-1458s21c1
Sequence:CCGGCCGAACTCCAACATCATGTTACTCGAGTAACATGATGTTGGAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks