EMAIL THIS PAGE TO A FRIEND

TBL1XR1

transducin (beta)-like 1 X-linked receptor 1

Synonyms: C21 DC42 IRA1 TBLR1
UniProtKB ID: Q9BZK7, D3DNQ9, Q14DC3, Q9H2I1, Q9H9A1
Gene ID:
Human(79718) Summary: The protein encoded by this gene has sequence similarity with members of the WD40 repeat-containing protein family. The WD40 group is a large family of proteins, which appear to have a regulatory function. It is believed that the WD40 repeats mediate protein-protein interactions and members of the family are involved in signal transduction, RNA processing, gene regulation, vesicular trafficking, cytoskeletal assembly and may play a role in the control of cytotypic differentiation. [provided by RefSeq, Jul 2008]
Mouse(81004) transducin (beta)-like 1X-linked receptor 1
Rat(365755) transducin (beta)-like 1 X-linked receptor 1
domestic guinea pig(100733958) transducin (beta)-like 1 X-linked receptor 1
naked mole-rat(101708107) transducin (beta)-like 1 X-linked receptor 1
Domestic Rabbit(100358446) transducin (beta)-like 1 X-linked receptor 1
cow(614346) transducin (beta)-like 1 X-linked receptor 1
sheep(101111508) transducin (beta)-like 1 X-linked receptor 1
chicken(426284) transducin (beta)-like 1 X-linked receptor 1
domestic cat(101098398) transducin (beta)-like 1 X-linked receptor 1
dog(488176) transducin (beta)-like 1 X-linked receptor 1
254 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024665 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024665 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024665 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030732 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030732 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030732 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024665 Rosetta Predictions human pricing
NM_001108941 Rosetta Predictions rat pricing
NM_030732 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104372 predicted 664
2 SASI_Hs01_00104373 predicted 535
3 SASI_Hs01_00104374 predicted 356
4 SASI_Hs02_00357074 predicted 1800
5 SASI_Hs01_00104376 predicted 878
6 SASI_Hs01_00104377 predicted 1591
7 SASI_Hs02_00357075 predicted 416
8 SASI_Hs01_00104378 predicted 1031
9 SASI_Hs01_00104379 predicted 983
10 SASI_Hs01_00104380 predicted 841
11 SASI_Hs01_00104375 predicted 1106
12 SASI_Hs01_00104381 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108941 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243594 predicted 1183
2 SASI_Rn02_00243595 predicted 408
3 SASI_Rn02_00243596 predicted 1741
4 SASI_Rn02_00243597 predicted 1796
5 SASI_Rn02_00243598 predicted 1090
6 SASI_Rn02_00243599 predicted 241
7 SASI_Rn02_00243600 predicted 252
8 SASI_Rn02_00243601 predicted 1819
9 SASI_Rn02_00243602 predicted 319
10 SASI_Rn02_00243603 predicted 931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030732 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179841 predicted 1367
2 SASI_Mm01_00179842 predicted 2010
3 SASI_Mm01_00179843 predicted 1148
4 SASI_Mm01_00179844 predicted 1249
5 SASI_Mm01_00179845 predicted 1341
6 SASI_Mm01_00179846 predicted 818
7 SASI_Mm01_00179847 predicted 1279
8 SASI_Mm01_00179848 predicted 1983
9 SASI_Mm01_00179849 predicted 435
10 SASI_Mm02_00336922 predicted 1126
11 SASI_Mm01_00179850 predicted 316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024665
VALIDATED
TBL1XR1 MISSION shRNA Bacterial Glycerol Stock
transducin (beta)-like 1 X-linked receptor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024665.4-1270s21c1
Sequence:CCGGGGACAAGACAGACCTATTAAACTCGAGTTTAATAGGTCTGTCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024665.4-1785s21c1
Sequence:CCGGTGTATTAGACCTTCGGAAATACTCGAGTATTTCCGAAGGTCTAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024665.4-1051s21c1
Sequence:CCGGCAGCATAAAGGCCCTATATTTCTCGAGAAATATAGGGCCTTTATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024665.4-1471s21c1
Sequence:CCGGCCAGGGACTAATAATCCAAATCTCGAGATTTGGATTATTAGTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024665.4-2170s21c1
Sequence:CCGGAGCAGACACCATGGATTATATCTCGAGATATAATCCATGGTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024665.2-1436s1c1
Sequence:CCGGCCAGGGACTAATAATCCAAATCTCGAGATTTGGATTATTAGTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024665.2-306s1c1
Sequence:CCGGCCTTTGGTATAGAAAGCCATACTCGAGTATGGCTTTCTATACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024665.2-364s1c1
Sequence:CCGGCGCTGCATTGATTTCTATCATCTCGAGATGATAGAAATCAATGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024665.2-1151s1c1
Sequence:CCGGGCACCAGCATTGGATGTTGATCTCGAGATCAACATCCAATGCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024665.2-1015s1c1
Sequence:CCGGGCAGCATAAAGGCCCTATATTCTCGAGAATATAGGGCCTTTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024665
VALIDATED
TBL1XR1 MISSION shRNA shRNA Plasmid DNA
transducin (beta)-like 1 X-linked receptor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024665.4-1270s21c1
Sequence:CCGGGGACAAGACAGACCTATTAAACTCGAGTTTAATAGGTCTGTCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024665.4-1785s21c1
Sequence:CCGGTGTATTAGACCTTCGGAAATACTCGAGTATTTCCGAAGGTCTAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024665.4-1051s21c1
Sequence:CCGGCAGCATAAAGGCCCTATATTTCTCGAGAAATATAGGGCCTTTATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024665.4-1471s21c1
Sequence:CCGGCCAGGGACTAATAATCCAAATCTCGAGATTTGGATTATTAGTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024665.4-2170s21c1
Sequence:CCGGAGCAGACACCATGGATTATATCTCGAGATATAATCCATGGTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024665.2-1436s1c1
Sequence:CCGGCCAGGGACTAATAATCCAAATCTCGAGATTTGGATTATTAGTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024665.2-306s1c1
Sequence:CCGGCCTTTGGTATAGAAAGCCATACTCGAGTATGGCTTTCTATACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024665.2-364s1c1
Sequence:CCGGCGCTGCATTGATTTCTATCATCTCGAGATGATAGAAATCAATGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024665.2-1151s1c1
Sequence:CCGGGCACCAGCATTGGATGTTGATCTCGAGATCAACATCCAATGCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024665.2-1015s1c1
Sequence:CCGGGCAGCATAAAGGCCCTATATTCTCGAGAATATAGGGCCTTTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024665
VALIDATED
TBL1XR1 MISSION shRNA Lentiviral Transduction Particles
transducin (beta)-like 1 X-linked receptor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024665.4-1270s21c1
Sequence:CCGGGGACAAGACAGACCTATTAAACTCGAGTTTAATAGGTCTGTCTTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024665.4-1785s21c1
Sequence:CCGGTGTATTAGACCTTCGGAAATACTCGAGTATTTCCGAAGGTCTAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024665.4-1051s21c1
Sequence:CCGGCAGCATAAAGGCCCTATATTTCTCGAGAAATATAGGGCCTTTATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024665.4-1471s21c1
Sequence:CCGGCCAGGGACTAATAATCCAAATCTCGAGATTTGGATTATTAGTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024665.4-2170s21c1
Sequence:CCGGAGCAGACACCATGGATTATATCTCGAGATATAATCCATGGTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024665.2-1436s1c1
Sequence:CCGGCCAGGGACTAATAATCCAAATCTCGAGATTTGGATTATTAGTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024665.2-306s1c1
Sequence:CCGGCCTTTGGTATAGAAAGCCATACTCGAGTATGGCTTTCTATACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024665.2-364s1c1
Sequence:CCGGCGCTGCATTGATTTCTATCATCTCGAGATGATAGAAATCAATGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024665.2-1151s1c1
Sequence:CCGGGCACCAGCATTGGATGTTGATCTCGAGATCAACATCCAATGCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024665.2-1015s1c1
Sequence:CCGGGCAGCATAAAGGCCCTATATTCTCGAGAATATAGGGCCTTTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030732
VALIDATED
TBL1XR1 MISSION shRNA Bacterial Glycerol Stock
transducin (beta)-like 1 X-linked receptor 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030732.3-2449s21c1
Sequence:CCGGGCATGAAGTAAGGGAGTGAATCTCGAGATTCACTCCCTTACTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030732.3-827s21c1
Sequence:CCGGGCACATACCATCGCAAATAATCTCGAGATTATTTGCGATGGTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030732.3-495s21c1
Sequence:CCGGCCTTTGGTATAGAGAGCCATACTCGAGTATGGCTCTCTATACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030732.3-1667s21c1
Sequence:CCGGGCATCCTTTGATTCTACAGTTCTCGAGAACTGTAGAATCAAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030732.2-2319s1c1
Sequence:CCGGGCATGAAGTAAGGGAGTGAATCTCGAGATTCACTCCCTTACTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030732.2-365s1c1
Sequence:CCGGCCTTTGGTATAGAGAGCCATACTCGAGTATGGCTCTCTATACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030732.2-1140s1c1
Sequence:CCGGCGTAGATAAGACCACCATCATCTCGAGATGATGGTGGTCTTATCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030732.2-697s1c1
Sequence:CCGGGCACATACCATCGCAAATAATCTCGAGATTATTTGCGATGGTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030732.2-1537s1c1
Sequence:CCGGGCATCCTTTGATTCTACAGTTCTCGAGAACTGTAGAATCAAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030732
VALIDATED
TBL1XR1 MISSION shRNA shRNA Plasmid DNA
transducin (beta)-like 1 X-linked receptor 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030732.3-2449s21c1
Sequence:CCGGGCATGAAGTAAGGGAGTGAATCTCGAGATTCACTCCCTTACTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030732.3-827s21c1
Sequence:CCGGGCACATACCATCGCAAATAATCTCGAGATTATTTGCGATGGTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030732.3-495s21c1
Sequence:CCGGCCTTTGGTATAGAGAGCCATACTCGAGTATGGCTCTCTATACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030732.3-1667s21c1
Sequence:CCGGGCATCCTTTGATTCTACAGTTCTCGAGAACTGTAGAATCAAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030732.2-2319s1c1
Sequence:CCGGGCATGAAGTAAGGGAGTGAATCTCGAGATTCACTCCCTTACTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030732.2-365s1c1
Sequence:CCGGCCTTTGGTATAGAGAGCCATACTCGAGTATGGCTCTCTATACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030732.2-1140s1c1
Sequence:CCGGCGTAGATAAGACCACCATCATCTCGAGATGATGGTGGTCTTATCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030732.2-697s1c1
Sequence:CCGGGCACATACCATCGCAAATAATCTCGAGATTATTTGCGATGGTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030732.2-1537s1c1
Sequence:CCGGGCATCCTTTGATTCTACAGTTCTCGAGAACTGTAGAATCAAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030732
VALIDATED
TBL1XR1 MISSION shRNA Lentiviral Transduction Particles
transducin (beta)-like 1 X-linked receptor 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030732.3-2449s21c1
Sequence:CCGGGCATGAAGTAAGGGAGTGAATCTCGAGATTCACTCCCTTACTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030732.3-827s21c1
Sequence:CCGGGCACATACCATCGCAAATAATCTCGAGATTATTTGCGATGGTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030732.3-495s21c1
Sequence:CCGGCCTTTGGTATAGAGAGCCATACTCGAGTATGGCTCTCTATACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030732.3-1667s21c1
Sequence:CCGGGCATCCTTTGATTCTACAGTTCTCGAGAACTGTAGAATCAAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030732.2-2319s1c1
Sequence:CCGGGCATGAAGTAAGGGAGTGAATCTCGAGATTCACTCCCTTACTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030732.2-365s1c1
Sequence:CCGGCCTTTGGTATAGAGAGCCATACTCGAGTATGGCTCTCTATACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030732.2-1140s1c1
Sequence:CCGGCGTAGATAAGACCACCATCATCTCGAGATGATGGTGGTCTTATCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030732.2-697s1c1
Sequence:CCGGGCACATACCATCGCAAATAATCTCGAGATTATTTGCGATGGTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030732.2-1537s1c1
Sequence:CCGGGCATCCTTTGATTCTACAGTTCTCGAGAACTGTAGAATCAAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks