EMAIL THIS PAGE TO A FRIEND

TBL1Y

transducin (beta)-like 1, Y-linked

Synonyms: TBL1
Species: Human TBL1Y(90665)
UniProtKB ID: Q9BQ87, A1L4B3
Gene ID:
Human(90665) Summary: The protein encoded by this gene has sequence similarity with members of the WD40 repeat-containing protein family. The WD40 group is a large family of proteins, which appear to have a regulatory function. It is believed that the WD40 repeats mediate protein-protein interactions and members of the family are involved in signal transduction, RNA processing, gene regulation, vesicular trafficking, cytoskeletal assembly and may play a role in the control of cytotypic differentiation. This gene is highly similar to TBL1X gene in nucleotide sequence and protein sequence, but the TBL1X gene is located on chromosome X and this gene is on chromosome Y. This gene has three alternatively spliced transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033284 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033284 Rosetta Predictions human pricing
NM_134258 Rosetta Predictions human pricing
NM_134259 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178465 predicted 1082
2 SASI_Hs01_00178466 predicted 2058
3 SASI_Hs01_00178467 predicted 822
4 SASI_Hs01_00178468 predicted 1042
5 SASI_Hs01_00178469 predicted 2174
6 SASI_Hs01_00178470 predicted 2049
7 SASI_Hs01_00178471 predicted 1133
8 SASI_Hs01_00178472 predicted 892
9 SASI_Hs01_00178473 predicted 1102
10 SASI_Hs01_00178474 predicted 761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191006 predicted 1049
2 SASI_Hs01_00191007 predicted 2027
3 SASI_Hs01_00191008 predicted 795
4 SASI_Hs01_00191009 predicted 1012
5 SASI_Hs01_00191010 predicted 2150
6 SASI_Hs01_00191011 predicted 2023
7 SASI_Hs01_00191012 predicted 1102
8 SASI_Hs01_00191013 predicted 861
9 SASI_Hs01_00191014 predicted 1072
10 SASI_Hs01_00191015 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135714 predicted 986
2 SASI_Hs01_00135715 predicted 1962
3 SASI_Hs01_00135716 predicted 736
4 SASI_Hs01_00135717 predicted 951
5 SASI_Hs01_00135718 predicted 2081
6 SASI_Hs01_00135719 predicted 1961
7 SASI_Hs01_00135720 predicted 1041
8 SASI_Hs01_00135721 predicted 794
9 SASI_Hs01_00135722 predicted 1012
10 SASI_Hs01_00135723 predicted 667
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033284
TBL1Y MISSION shRNA Bacterial Glycerol Stock
transducin (beta)-like 1, Y-linked
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033284.1-1898s1c1
Sequence:CCGGCAACCCAAACTCCAGCATCATCTCGAGATGATGCTGGAGTTTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033284.1-1484s1c1
Sequence:CCGGCTTCGCTCTGAAATGGAACAACTCGAGTTGTTCCATTTCAGAGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033284.1-1243s1c1
Sequence:CCGGGAGACTCAACTGCAAGGATATCTCGAGATATCCTTGCAGTTGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033284.1-1340s1c1
Sequence:CCGGCGTCCCAAGTAATAAAGATGTCTCGAGACATCTTTATTACTTGGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033284.1-1376s1c1
Sequence:CCGGGAACAGTGATGGAACACTATTCTCGAGAATAGTGTTCCATCACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033284.1-1301s1c1
Sequence:CCGGGCTCGTGTTGAGACATTGTATCTCGAGATACAATGTCTCAACACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033284.1-2006s1c1
Sequence:CCGGGCCTGTCTACAGTGTAGCTTTCTCGAGAAAGCTACACTGTAGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033284.1-1178s21c1
Sequence:CCGGCCACGAGTCTGAGGTGTTCATCTCGAGATGAACACCTCAGACTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033284.1-1818s21c1
Sequence:CCGGGATGCATGCGTCCACGATCTTCTCGAGAAGATCGTGGACGCATGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033284
TBL1Y MISSION shRNA shRNA Plasmid DNA
transducin (beta)-like 1, Y-linked
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033284.1-1898s1c1
Sequence:CCGGCAACCCAAACTCCAGCATCATCTCGAGATGATGCTGGAGTTTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033284.1-1484s1c1
Sequence:CCGGCTTCGCTCTGAAATGGAACAACTCGAGTTGTTCCATTTCAGAGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033284.1-1243s1c1
Sequence:CCGGGAGACTCAACTGCAAGGATATCTCGAGATATCCTTGCAGTTGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033284.1-1340s1c1
Sequence:CCGGCGTCCCAAGTAATAAAGATGTCTCGAGACATCTTTATTACTTGGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033284.1-1376s1c1
Sequence:CCGGGAACAGTGATGGAACACTATTCTCGAGAATAGTGTTCCATCACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033284.1-1301s1c1
Sequence:CCGGGCTCGTGTTGAGACATTGTATCTCGAGATACAATGTCTCAACACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033284.1-2006s1c1
Sequence:CCGGGCCTGTCTACAGTGTAGCTTTCTCGAGAAAGCTACACTGTAGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033284.1-1178s21c1
Sequence:CCGGCCACGAGTCTGAGGTGTTCATCTCGAGATGAACACCTCAGACTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033284.1-1818s21c1
Sequence:CCGGGATGCATGCGTCCACGATCTTCTCGAGAAGATCGTGGACGCATGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033284
TBL1Y MISSION shRNA Lentiviral Transduction Particles
transducin (beta)-like 1, Y-linked
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033284.1-1898s1c1
Sequence:CCGGCAACCCAAACTCCAGCATCATCTCGAGATGATGCTGGAGTTTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033284.1-1484s1c1
Sequence:CCGGCTTCGCTCTGAAATGGAACAACTCGAGTTGTTCCATTTCAGAGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033284.1-1243s1c1
Sequence:CCGGGAGACTCAACTGCAAGGATATCTCGAGATATCCTTGCAGTTGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033284.1-1340s1c1
Sequence:CCGGCGTCCCAAGTAATAAAGATGTCTCGAGACATCTTTATTACTTGGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033284.1-1376s1c1
Sequence:CCGGGAACAGTGATGGAACACTATTCTCGAGAATAGTGTTCCATCACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033284.1-1301s1c1
Sequence:CCGGGCTCGTGTTGAGACATTGTATCTCGAGATACAATGTCTCAACACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033284.1-2006s1c1
Sequence:CCGGGCCTGTCTACAGTGTAGCTTTCTCGAGAAAGCTACACTGTAGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033284.1-1178s21c1
Sequence:CCGGCCACGAGTCTGAGGTGTTCATCTCGAGATGAACACCTCAGACTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033284.1-1818s21c1
Sequence:CCGGGATGCATGCGTCCACGATCTTCTCGAGAAGATCGTGGACGCATGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks