EMAIL THIS PAGE TO A FRIEND

TBL2

transducin (beta)-like 2

Synonyms: WBSCR13 WS-betaTRP
UniProtKB ID: Q9Y4P3, Q9UQE2
Gene ID:
Human(26608) Summary: This gene encodes a member of the beta-transducin protein family. Most proteins of the beta-transducin family are involved in regulatory functions. This protein is possibly involved in some intracellular signaling pathway. This gene is deleted in Williams-Beuren syndrome, a developmental disorder caused by deletion of multiple genes at 7q11.23. [provided by RefSeq, Jul 2008]
Mouse(27368) transducin (beta)-like 2
Rat(686610) transducin (beta)-like 2
Thale Cress(842373) hypothetical protein
Horse(100059856) transducin (beta)-like 2
domestic cat(101092907) transducin (beta)-like 2
chicken(101668538) transducin (beta)-like 2
chicken(101751077) transducin (beta)-like 2
chicken(770276) transducin (beta)-like 2
dog(479718) transducin (beta)-like 2
Zebrafish(337068) transducin (beta)-like 2
cow(511758) transducin (beta)-like 2
sheep(101115752) transducin (beta)-like 2
Domestic Rabbit(100342247) transducin (beta)-like 2
naked mole-rat(101707162) transducin (beta)-like 2
domestic guinea pig(100731105) transducin (beta)-like 2
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013763 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013763 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013763 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012453 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012453 Rosetta Predictions human pricing
XM_001071365 Rosetta Predictions rat pricing
NM_013763 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344361 predicted 275
2 SASI_Hs01_00123920 predicted 1252
3 SASI_Hs01_00123922 predicted 310
4 SASI_Hs01_00123923 predicted 839
5 SASI_Hs01_00123924 predicted 1259
6 SASI_Hs01_00123925 predicted 431
7 SASI_Hs01_00123927 predicted 316
8 SASI_Hs01_00123928 predicted 784
9 SASI_Hs01_00123929 predicted 802
10 SASI_Hs02_00344362 predicted 695
11 SASI_Hs01_00123921 predicted 303
12 SASI_Hs01_00123926 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071365 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334815 predicted 212
2 SASI_Rn02_00334816 predicted 1108
3 SASI_Rn02_00334817 predicted 213
4 SASI_Rn02_00334818 predicted 1826
5 SASI_Rn02_00334819 predicted 753
6 SASI_Rn02_00334820 predicted 693
7 SASI_Rn02_00334821 predicted 1175
8 SASI_Rn02_00334822 predicted 247
9 SASI_Rn02_00334823 predicted 406
10 SASI_Rn02_00334824 predicted 1816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013763 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050033 predicted 682
2 SASI_Mm01_00050034 predicted 198
3 SASI_Mm01_00050035 predicted 1063
4 SASI_Mm01_00050037 predicted 1484
5 SASI_Mm01_00050038 predicted 1632
6 SASI_Mm01_00050039 predicted 356
7 SASI_Mm01_00050040 predicted 703
8 SASI_Mm02_00322711 predicted 1129
9 SASI_Mm01_00050042 predicted 639
10 SASI_Mm02_00322712 predicted 737
11 SASI_Mm01_00050036 predicted 1133
12 SASI_Mm01_00050041 predicted 828
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013763
VALIDATED
TBL2 MISSION shRNA Bacterial Glycerol Stock
transducin (beta)-like 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013763.2-308s21c1
Sequence:CCGGTCAGCAGCAACGGCAAGTATCCTCGAGGATACTTGCCGTTGCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013763.2-705s21c1
Sequence:CCGGGAACAACAGTCACGCAGTTATCTCGAGATAACTGCGTGACTGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013763.2-1703s21c1
Sequence:CCGGTAGGGTCACCAGGGACAAATTCTCGAGAATTTGTCCCTGGTGACCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013763.2-1794s21c1
Sequence:CCGGGATAGCAGCAAGAAGTAATTACTCGAGTAATTACTTCTTGCTGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013763.2-1054s21c1
Sequence:CCGGTTGGCCACTGGCACCAATATTCTCGAGAATATTGGTGCCAGTGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013763.2-356s21c1
Sequence:CCGGTCCGTATCTGGAGCACTAAAGCTCGAGCTTTAGTGCTCCAGATACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013763.2-636s1c1
Sequence:CCGGCAGTGACACAACTGTCCTCATCTCGAGATGAGGACAGTTGTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013763.2-684s1c1
Sequence:CCGGCACGATCAACACTAACCAGATCTCGAGATCTGGTTAGTGTTGATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013763.2-364s1c1
Sequence:CCGGTGGAGCACTAAAGATTTCCTTCTCGAGAAGGAAATCTTTAGTGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013763.2-784s1c1
Sequence:CCGGGAGGTCTGTTTCGGGAAGAAACTCGAGTTTCTTCCCGAAACAGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013763.2-2471s1c1
Sequence:CCGGCCGTAGTCAATCCAGGACAATCTCGAGATTGTCCTGGATTGACTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013763
VALIDATED
TBL2 MISSION shRNA shRNA Plasmid DNA
transducin (beta)-like 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013763.2-308s21c1
Sequence:CCGGTCAGCAGCAACGGCAAGTATCCTCGAGGATACTTGCCGTTGCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013763.2-705s21c1
Sequence:CCGGGAACAACAGTCACGCAGTTATCTCGAGATAACTGCGTGACTGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013763.2-1703s21c1
Sequence:CCGGTAGGGTCACCAGGGACAAATTCTCGAGAATTTGTCCCTGGTGACCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013763.2-1794s21c1
Sequence:CCGGGATAGCAGCAAGAAGTAATTACTCGAGTAATTACTTCTTGCTGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013763.2-1054s21c1
Sequence:CCGGTTGGCCACTGGCACCAATATTCTCGAGAATATTGGTGCCAGTGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013763.2-356s21c1
Sequence:CCGGTCCGTATCTGGAGCACTAAAGCTCGAGCTTTAGTGCTCCAGATACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013763.2-636s1c1
Sequence:CCGGCAGTGACACAACTGTCCTCATCTCGAGATGAGGACAGTTGTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013763.2-684s1c1
Sequence:CCGGCACGATCAACACTAACCAGATCTCGAGATCTGGTTAGTGTTGATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013763.2-364s1c1
Sequence:CCGGTGGAGCACTAAAGATTTCCTTCTCGAGAAGGAAATCTTTAGTGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013763.2-784s1c1
Sequence:CCGGGAGGTCTGTTTCGGGAAGAAACTCGAGTTTCTTCCCGAAACAGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013763.2-2471s1c1
Sequence:CCGGCCGTAGTCAATCCAGGACAATCTCGAGATTGTCCTGGATTGACTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013763
VALIDATED
TBL2 MISSION shRNA Lentiviral Transduction Particles
transducin (beta)-like 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013763.2-308s21c1
Sequence:CCGGTCAGCAGCAACGGCAAGTATCCTCGAGGATACTTGCCGTTGCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013763.2-705s21c1
Sequence:CCGGGAACAACAGTCACGCAGTTATCTCGAGATAACTGCGTGACTGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013763.2-1703s21c1
Sequence:CCGGTAGGGTCACCAGGGACAAATTCTCGAGAATTTGTCCCTGGTGACCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013763.2-1794s21c1
Sequence:CCGGGATAGCAGCAAGAAGTAATTACTCGAGTAATTACTTCTTGCTGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013763.2-1054s21c1
Sequence:CCGGTTGGCCACTGGCACCAATATTCTCGAGAATATTGGTGCCAGTGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013763.2-356s21c1
Sequence:CCGGTCCGTATCTGGAGCACTAAAGCTCGAGCTTTAGTGCTCCAGATACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013763.2-636s1c1
Sequence:CCGGCAGTGACACAACTGTCCTCATCTCGAGATGAGGACAGTTGTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013763.2-684s1c1
Sequence:CCGGCACGATCAACACTAACCAGATCTCGAGATCTGGTTAGTGTTGATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013763.2-364s1c1
Sequence:CCGGTGGAGCACTAAAGATTTCCTTCTCGAGAAGGAAATCTTTAGTGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013763.2-784s1c1
Sequence:CCGGGAGGTCTGTTTCGGGAAGAAACTCGAGTTTCTTCCCGAAACAGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013763.2-2471s1c1
Sequence:CCGGCCGTAGTCAATCCAGGACAATCTCGAGATTGTCCTGGATTGACTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012453
VALIDATED
TBL2 MISSION shRNA Bacterial Glycerol Stock
transducin (beta)-like 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012453.2-1176s21c1
Sequence:CCGGTTGGCCAGTGGCAGTAGTATTCTCGAGAATACTACTGCCACTGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012453.2-941s21c1
Sequence:CCGGGGTGCGAGCCTTCGAACTAAACTCGAGTTTAGTTCGAAGGCTCGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012453.2-797s21c1
Sequence:CCGGGCTGTCTACCATCAACACCAACTCGAGTTGGTGTTGATGGTAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012453.2-409s21c1
Sequence:CCGGACATATCTTGCATGGACTTTACTCGAGTAAAGTCCATGCAAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012453.2-1849s21c1
Sequence:CCGGAGAGAACACCTGAGTACTAAGCTCGAGCTTAGTACTCAGGTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_012453.1-246s1c1
Sequence:CCGGCACCTGACAAATCTTCGGGATCTCGAGATCCCGAAGATTTGTCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012453.1-1222s1c1
Sequence:CCGGCGCCAACTTGTCCTTTGACATCTCGAGATGTCAAAGGACAAGTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_012453.1-757s1c1
Sequence:CCGGGCTGTCTACCATCAACACCAACTCGAGTTGGTGTTGATGGTAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_012453.1-662s1c1
Sequence:CCGGCCTGTCATCGACATTGGCATTCTCGAGAATGCCAATGTCGATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012453.1-667s1c1
Sequence:CCGGCATCGACATTGGCATTGCTAACTCGAGTTAGCAATGCCAATGTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012453.1-845s1c1
Sequence:CCGGCCAGATGTGAAGGTTTGGGAACTCGAGTTCCCAAACCTTCACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012453.1-367s1c1
Sequence:CCGGGAACATATCTTGCATGGACTTCTCGAGAAGTCCATGCAAGATATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012453.1-1968s1c1
Sequence:CCGGGCAAAGATGATATGAGGCTAACTCGAGTTAGCCTCATATCATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012453
VALIDATED
TBL2 MISSION shRNA shRNA Plasmid DNA
transducin (beta)-like 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012453.2-1176s21c1
Sequence:CCGGTTGGCCAGTGGCAGTAGTATTCTCGAGAATACTACTGCCACTGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012453.2-941s21c1
Sequence:CCGGGGTGCGAGCCTTCGAACTAAACTCGAGTTTAGTTCGAAGGCTCGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012453.2-797s21c1
Sequence:CCGGGCTGTCTACCATCAACACCAACTCGAGTTGGTGTTGATGGTAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012453.2-409s21c1
Sequence:CCGGACATATCTTGCATGGACTTTACTCGAGTAAAGTCCATGCAAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012453.2-1849s21c1
Sequence:CCGGAGAGAACACCTGAGTACTAAGCTCGAGCTTAGTACTCAGGTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_012453.1-246s1c1
Sequence:CCGGCACCTGACAAATCTTCGGGATCTCGAGATCCCGAAGATTTGTCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012453.1-1222s1c1
Sequence:CCGGCGCCAACTTGTCCTTTGACATCTCGAGATGTCAAAGGACAAGTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_012453.1-757s1c1
Sequence:CCGGGCTGTCTACCATCAACACCAACTCGAGTTGGTGTTGATGGTAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_012453.1-662s1c1
Sequence:CCGGCCTGTCATCGACATTGGCATTCTCGAGAATGCCAATGTCGATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012453.1-667s1c1
Sequence:CCGGCATCGACATTGGCATTGCTAACTCGAGTTAGCAATGCCAATGTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012453.1-845s1c1
Sequence:CCGGCCAGATGTGAAGGTTTGGGAACTCGAGTTCCCAAACCTTCACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012453.1-367s1c1
Sequence:CCGGGAACATATCTTGCATGGACTTCTCGAGAAGTCCATGCAAGATATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012453.1-1968s1c1
Sequence:CCGGGCAAAGATGATATGAGGCTAACTCGAGTTAGCCTCATATCATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012453
VALIDATED
TBL2 MISSION shRNA Lentiviral Transduction Particles
transducin (beta)-like 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012453.2-1176s21c1
Sequence:CCGGTTGGCCAGTGGCAGTAGTATTCTCGAGAATACTACTGCCACTGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012453.2-941s21c1
Sequence:CCGGGGTGCGAGCCTTCGAACTAAACTCGAGTTTAGTTCGAAGGCTCGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012453.2-797s21c1
Sequence:CCGGGCTGTCTACCATCAACACCAACTCGAGTTGGTGTTGATGGTAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012453.2-409s21c1
Sequence:CCGGACATATCTTGCATGGACTTTACTCGAGTAAAGTCCATGCAAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012453.2-1849s21c1
Sequence:CCGGAGAGAACACCTGAGTACTAAGCTCGAGCTTAGTACTCAGGTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_012453.1-246s1c1
Sequence:CCGGCACCTGACAAATCTTCGGGATCTCGAGATCCCGAAGATTTGTCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012453.1-1222s1c1
Sequence:CCGGCGCCAACTTGTCCTTTGACATCTCGAGATGTCAAAGGACAAGTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_012453.1-757s1c1
Sequence:CCGGGCTGTCTACCATCAACACCAACTCGAGTTGGTGTTGATGGTAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_012453.1-662s1c1
Sequence:CCGGCCTGTCATCGACATTGGCATTCTCGAGAATGCCAATGTCGATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012453.1-667s1c1
Sequence:CCGGCATCGACATTGGCATTGCTAACTCGAGTTAGCAATGCCAATGTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012453.1-845s1c1
Sequence:CCGGCCAGATGTGAAGGTTTGGGAACTCGAGTTCCCAAACCTTCACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012453.1-367s1c1
Sequence:CCGGGAACATATCTTGCATGGACTTCTCGAGAAGTCCATGCAAGATATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012453.1-1968s1c1
Sequence:CCGGGCAAAGATGATATGAGGCTAACTCGAGTTAGCCTCATATCATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks