EMAIL THIS PAGE TO A FRIEND

TBL3

transducin (beta)-like 3

Synonyms: SAZD UTP13
UniProtKB ID: Q12788, Q59GD6, Q8IVB7, Q96A78
Gene ID:
Human(10607) Summary: The protein encoded by this gene has sequence similarity with members of the WD40 repeat-containing protein family. The WD40 group is a large family of proteins, which appear to have a regulatory function. It is believed that the WD40 repeats mediate protein-protein interactions and members of the family are involved in signal transduction, RNA processing, gene regulation, vesicular trafficking, cytoskeletal assembly and may play a role in the control of cytotypic differentiation. This gene has multiple polyadenylation sites. It might have multiple alternatively spliced transcript variants but the variants have not been fully described yet. [provided by RefSeq, Jul 2008]
Mouse(213773) transducin (beta)-like 3
Rat(287120) transducin (beta)-like 3
Thale Cress(830298) hypothetical protein
Horse(100065596) transducin (beta)-like 3
domestic cat(101084250) transducin (beta)-like 3
dog(490064) transducin (beta)-like 3
chicken(416545) transducin (beta)-like 3
Zebrafish(492761) transducin (beta)-like 3
domestic guinea pig(100729859) transducin (beta)-like 3
naked mole-rat(101722099) transducin (beta)-like 3
cow(618429) transducin (beta)-like 3
sheep(101112621) transducin (beta)-like 3
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006453 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145396 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145396 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145396 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006453 Rosetta Predictions human pricing
NM_001008277 Rosetta Predictions rat pricing
NM_145396 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123399 predicted 923
2 SASI_Hs02_00341596 predicted 818
3 SASI_Hs01_00123400 predicted 1455
4 SASI_Hs01_00123401 predicted 1355
5 SASI_Hs01_00123402 predicted 2072
6 SASI_Hs01_00123404 predicted 1515
7 SASI_Hs01_00123405 predicted 504
8 SASI_Hs01_00123406 predicted 744
9 SASI_Hs01_00123407 predicted 379
10 SASI_Hs01_00123408 predicted 405
11 SASI_Hs01_00123403 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008277 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103750 predicted 1776
2 SASI_Rn01_00103751 predicted 2216
3 SASI_Rn01_00103752 predicted 2107
4 SASI_Rn01_00103753 predicted 1160
5 SASI_Rn01_00103754 predicted 1271
6 SASI_Rn01_00103755 predicted 1018
7 SASI_Rn01_00103756 predicted 1098
8 SASI_Rn01_00103757 predicted 718
9 SASI_Rn01_00103758 predicted 1272
10 SASI_Rn01_00103759 predicted 1816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154287 predicted 1064
2 SASI_Mm01_00154288 predicted 732
3 SASI_Mm01_00154289 predicted 1082
4 SASI_Mm01_00154290 predicted 1341
5 SASI_Mm01_00154292 predicted 2156
6 SASI_Mm01_00154293 predicted 659
7 SASI_Mm01_00154294 predicted 1209
8 SASI_Mm01_00154295 predicted 1036
9 SASI_Mm02_00340726 predicted 1411
10 SASI_Mm01_00154296 predicted 315
11 SASI_Mm01_00154291 predicted 1186
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006453
VALIDATED
TBL3 MISSION shRNA Bacterial Glycerol Stock
transducin (beta)-like 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000454947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006453.2-1149s21c1
Sequence:CCGGCGTTGTCGTGGCCTCCAATAGCTCGAGCTATTGGAGGCCACGACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006453.2-1302s1c1
Sequence:CCGGCCGTATCTGGAGAATGAACAACTCGAGTTGTTCATTCTCCAGATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006453.2-1866s1c1
Sequence:CCGGGCTCTGGACCATCAAGAACAACTCGAGTTGTTCTTGATGGTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006453.2-1530s1c1
Sequence:CCGGCTGCCATGATAAGGACATCAACTCGAGTTGATGTCCTTATCATGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006453.2-2386s1c1
Sequence:CCGGCCCTACACTGAGCGGCACTTTCTCGAGAAAGTGCCGCTCAGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006453.2-741s1c1
Sequence:CCGGCGGCCGTGACAAGATATGTATCTCGAGATACATATCTTGTCACGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006453.2-1759s21c1
Sequence:CCGGTTCAGCTGTCTCAAGACATTTCTCGAGAAATGTCTTGAGACAGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006453.2-1458s21c1
Sequence:CCGGCAAAGCCTTGCTGTCCAAGAACTCGAGTTCTTGGACAGCAAGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006453.2-2446s21c1
Sequence:CCGGGACTTCCTGTGGCACAACATGCTCGAGCATGTTGTGCCACAGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006453.2-1038s21c1
Sequence:CCGGCGACCACAACCTGTTGCTCTACTCGAGTAGAGCAACAGGTTGTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006453.2-230s21c1
Sequence:CCGGGTGGCACCAGAGTCAACATTCCTCGAGGAATGTTGACTCTGGTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006453.2-128s21c1
Sequence:CCGGGCCGCTTCAAGACCAACTATGCTCGAGCATAGTTGGTCTTGAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006453
VALIDATED
TBL3 MISSION shRNA shRNA Plasmid DNA
transducin (beta)-like 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000454947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006453.2-1149s21c1
Sequence:CCGGCGTTGTCGTGGCCTCCAATAGCTCGAGCTATTGGAGGCCACGACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006453.2-1302s1c1
Sequence:CCGGCCGTATCTGGAGAATGAACAACTCGAGTTGTTCATTCTCCAGATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006453.2-1866s1c1
Sequence:CCGGGCTCTGGACCATCAAGAACAACTCGAGTTGTTCTTGATGGTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006453.2-1530s1c1
Sequence:CCGGCTGCCATGATAAGGACATCAACTCGAGTTGATGTCCTTATCATGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006453.2-2386s1c1
Sequence:CCGGCCCTACACTGAGCGGCACTTTCTCGAGAAAGTGCCGCTCAGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006453.2-741s1c1
Sequence:CCGGCGGCCGTGACAAGATATGTATCTCGAGATACATATCTTGTCACGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006453.2-1759s21c1
Sequence:CCGGTTCAGCTGTCTCAAGACATTTCTCGAGAAATGTCTTGAGACAGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006453.2-1458s21c1
Sequence:CCGGCAAAGCCTTGCTGTCCAAGAACTCGAGTTCTTGGACAGCAAGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006453.2-2446s21c1
Sequence:CCGGGACTTCCTGTGGCACAACATGCTCGAGCATGTTGTGCCACAGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006453.2-1038s21c1
Sequence:CCGGCGACCACAACCTGTTGCTCTACTCGAGTAGAGCAACAGGTTGTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006453.2-230s21c1
Sequence:CCGGGTGGCACCAGAGTCAACATTCCTCGAGGAATGTTGACTCTGGTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006453.2-128s21c1
Sequence:CCGGGCCGCTTCAAGACCAACTATGCTCGAGCATAGTTGGTCTTGAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006453
VALIDATED
TBL3 MISSION shRNA Lentiviral Transduction Particles
transducin (beta)-like 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000454947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006453.2-1149s21c1
Sequence:CCGGCGTTGTCGTGGCCTCCAATAGCTCGAGCTATTGGAGGCCACGACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006453.2-1302s1c1
Sequence:CCGGCCGTATCTGGAGAATGAACAACTCGAGTTGTTCATTCTCCAGATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006453.2-1866s1c1
Sequence:CCGGGCTCTGGACCATCAAGAACAACTCGAGTTGTTCTTGATGGTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006453.2-1530s1c1
Sequence:CCGGCTGCCATGATAAGGACATCAACTCGAGTTGATGTCCTTATCATGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006453.2-2386s1c1
Sequence:CCGGCCCTACACTGAGCGGCACTTTCTCGAGAAAGTGCCGCTCAGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006453.2-741s1c1
Sequence:CCGGCGGCCGTGACAAGATATGTATCTCGAGATACATATCTTGTCACGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006453.2-1759s21c1
Sequence:CCGGTTCAGCTGTCTCAAGACATTTCTCGAGAAATGTCTTGAGACAGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006453.2-1458s21c1
Sequence:CCGGCAAAGCCTTGCTGTCCAAGAACTCGAGTTCTTGGACAGCAAGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006453.2-2446s21c1
Sequence:CCGGGACTTCCTGTGGCACAACATGCTCGAGCATGTTGTGCCACAGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006453.2-1038s21c1
Sequence:CCGGCGACCACAACCTGTTGCTCTACTCGAGTAGAGCAACAGGTTGTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006453.2-230s21c1
Sequence:CCGGGTGGCACCAGAGTCAACATTCCTCGAGGAATGTTGACTCTGGTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006453.2-128s21c1
Sequence:CCGGGCCGCTTCAAGACCAACTATGCTCGAGCATAGTTGGTCTTGAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145396
VALIDATED
TBL3 MISSION shRNA Bacterial Glycerol Stock
transducin (beta)-like 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145396.3-144s1c1
Sequence:CCGGGCGAAAGATTGAACCTTTCTACTCGAGTAGAAAGGTTCAATCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145396.3-1367s1c1
Sequence:CCGGCCATCTGCTGTTCTAGGCTAACTCGAGTTAGCCTAGAACAGCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145396.3-1854s1c1
Sequence:CCGGGCTGTGGACCATTAAGAGCAACTCGAGTTGCTCTTAATGGTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145396.3-316s1c1
Sequence:CCGGCCTGATGATGAAGTACTCGTACTCGAGTACGAGTACTTCATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145396.3-484s1c1
Sequence:CCGGGCTGTACGTGTTTGGGACATTCTCGAGAATGTCCCAAACACGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145396.4-315s21c1
Sequence:CCGGCCTGATGATGAAGTACTCGTACTCGAGTACGAGTACTTCATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145396.4-1366s21c1
Sequence:CCGGCCATCTGCTGTTCTAGGCTAACTCGAGTTAGCCTAGAACAGCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145396.4-1848s21c1
Sequence:CCGGCTGAAGCTGTGGACCATTAAGCTCGAGCTTAATGGTCCACAGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145396.4-143s21c1
Sequence:CCGGGCGAAAGATTGAACCTTTCTACTCGAGTAGAAAGGTTCAATCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145396.4-483s21c1
Sequence:CCGGGCTGTACGTGTTTGGGACATTCTCGAGAATGTCCCAAACACGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145396
VALIDATED
TBL3 MISSION shRNA shRNA Plasmid DNA
transducin (beta)-like 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145396.3-144s1c1
Sequence:CCGGGCGAAAGATTGAACCTTTCTACTCGAGTAGAAAGGTTCAATCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145396.3-1367s1c1
Sequence:CCGGCCATCTGCTGTTCTAGGCTAACTCGAGTTAGCCTAGAACAGCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145396.3-1854s1c1
Sequence:CCGGGCTGTGGACCATTAAGAGCAACTCGAGTTGCTCTTAATGGTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145396.3-316s1c1
Sequence:CCGGCCTGATGATGAAGTACTCGTACTCGAGTACGAGTACTTCATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145396.3-484s1c1
Sequence:CCGGGCTGTACGTGTTTGGGACATTCTCGAGAATGTCCCAAACACGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145396.4-315s21c1
Sequence:CCGGCCTGATGATGAAGTACTCGTACTCGAGTACGAGTACTTCATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145396.4-1366s21c1
Sequence:CCGGCCATCTGCTGTTCTAGGCTAACTCGAGTTAGCCTAGAACAGCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145396.4-1848s21c1
Sequence:CCGGCTGAAGCTGTGGACCATTAAGCTCGAGCTTAATGGTCCACAGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145396.4-143s21c1
Sequence:CCGGGCGAAAGATTGAACCTTTCTACTCGAGTAGAAAGGTTCAATCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145396.4-483s21c1
Sequence:CCGGGCTGTACGTGTTTGGGACATTCTCGAGAATGTCCCAAACACGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145396
VALIDATED
TBL3 MISSION shRNA Lentiviral Transduction Particles
transducin (beta)-like 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145396.3-144s1c1
Sequence:CCGGGCGAAAGATTGAACCTTTCTACTCGAGTAGAAAGGTTCAATCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145396.3-1367s1c1
Sequence:CCGGCCATCTGCTGTTCTAGGCTAACTCGAGTTAGCCTAGAACAGCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145396.3-1854s1c1
Sequence:CCGGGCTGTGGACCATTAAGAGCAACTCGAGTTGCTCTTAATGGTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145396.3-316s1c1
Sequence:CCGGCCTGATGATGAAGTACTCGTACTCGAGTACGAGTACTTCATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145396.3-484s1c1
Sequence:CCGGGCTGTACGTGTTTGGGACATTCTCGAGAATGTCCCAAACACGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145396.4-315s21c1
Sequence:CCGGCCTGATGATGAAGTACTCGTACTCGAGTACGAGTACTTCATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145396.4-1366s21c1
Sequence:CCGGCCATCTGCTGTTCTAGGCTAACTCGAGTTAGCCTAGAACAGCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145396.4-1848s21c1
Sequence:CCGGCTGAAGCTGTGGACCATTAAGCTCGAGCTTAATGGTCCACAGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145396.4-143s21c1
Sequence:CCGGGCGAAAGATTGAACCTTTCTACTCGAGTAGAAAGGTTCAATCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145396.4-483s21c1
Sequence:CCGGGCTGTACGTGTTTGGGACATTCTCGAGAATGTCCCAAACACGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks