EMAIL THIS PAGE TO A FRIEND

TBP

TATA box binding protein

Synonyms: GTF2D GTF2D1 HDL4 SCA17 TFIID
UniProtKB ID: P20226, B4E3B3, F5H869, Q16845, Q6IBM6, Q9UC02
Gene ID:
Human(6908) Summary: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 32-39, and expansion of the number of repeats increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2010]
Mouse(21374) TATA box binding protein
Rat(117526) TATA box binding protein
fruit fly(37476) TATA binding protein
domestic cat(101084200) TATA box binding protein
Zebrafish(368882) TATA box binding protein
chicken(395995) TATA box binding protein
dog(611193) TATA box binding protein
cow(516578) TATA box binding protein
sheep(100144760) TATA box binding protein
naked mole-rat(101702646) TATA box binding protein
domestic guinea pig(100733307) TATA box binding protein
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0107 AQUA Peptide FLDF[K] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, rat pricing
AQ0114 AQUA Peptide TTALIFSSG[K] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013684 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013684 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013684 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003194 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003194 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003194 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003194 Rosetta Predictions human pricing
NM_001004198 Rosetta Predictions rat pricing
NM_013684 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122768 predicted 842
2 SASI_Hs01_00122769 predicted 747
3 SASI_Hs01_00122770 predicted 748
4 SASI_Hs01_00122771 predicted 1538
5 SASI_Hs01_00122772 predicted 847
6 SASI_Hs01_00122773 predicted 786
7 SASI_Hs01_00122774 predicted 1013
8 SASI_Hs01_00122775 predicted 891
9 SASI_Hs01_00122776 predicted 981
10 SASI_Hs01_00122777 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004198 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079592 predicted 752
2 SASI_Rn01_00079593 predicted 724
3 SASI_Rn01_00079594 predicted 794
4 SASI_Rn02_00198163 predicted 1556
5 SASI_Rn01_00079595 predicted 1015
6 SASI_Rn01_00079596 predicted 1000
7 SASI_Rn01_00079597 predicted 816
8 SASI_Rn01_00079598 predicted 889
9 SASI_Rn01_00079601 predicted 1629
10 SASI_Rn02_00198164 predicted 814
11 SASI_Rn01_00079599 predicted 715
12 SASI_Rn01_00079600 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187613 predicted 698
2 SASI_Mm02_00322554 predicted 1012
3 SASI_Mm01_00187614 predicted 755
4 SASI_Mm02_00322555 predicted 1103
5 SASI_Mm02_00322556 predicted 1023
6 SASI_Mm02_00322557 predicted 1113
7 SASI_Mm02_00322558 predicted 1066
8 SASI_Mm02_00322559 predicted 1124
9 SASI_Mm01_00187616 predicted 744
10 SASI_Mm01_00187619 predicted 687
11 SASI_Mm01_00187612 predicted 453
12 SASI_Mm01_00187615 predicted 562
13 SASI_Mm01_00187617 predicted 741
14 SASI_Mm01_00187618 predicted 715
15 SASI_Mm01_00187620 predicted 681
16 SASI_Mm01_00187621 predicted 487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013684
VALIDATED
TBP MISSION shRNA Bacterial Glycerol Stock
TATA box binding protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013684.3-1416s21c1
Sequence:CCGGGGCGGCACTGCCCATTTATTTCTCGAGAAATAAATGGGCAGTGCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013684.3-1071s21c1
Sequence:CCGGCCAGAATTGTTCTCCTTATTTCTCGAGAAATAAGGAGAACAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013684.3-1020s21c1
Sequence:CCGGGTAGCTATGAGCCAGAATTATCTCGAGATAATTCTGGCTCATAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013684.3-798s21c1
Sequence:CCGGCACGGACAACTGCGTTGATTTCTCGAGAAATCAACGCAGTTGTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013684.3-678s21c1
Sequence:CCGGATATTGTATCTACCGTGAATCCTCGAGGATTCACGGTAGATACAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013684.1-790s1c1
Sequence:CCGGCCAGAATTATTTCCTGGATTACTCGAGTAATCCAGGAAATAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013684.1-675s1c1
Sequence:CCGGCCCAGCTAAGTTCTTAGACTTCTCGAGAAGTCTAAGAACTTAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013684.1-482s1c1
Sequence:CCGGCCATTGCACTTCGTGCAAGAACTCGAGTTCTTGCACGAAGTGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013684.1-81s1c1
Sequence:CCGGCTTTAGTCCAATGATGCCTTACTCGAGTAAGGCATCATTGGACTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013684.1-233s1c1
Sequence:CCGGCAGCCTCAGTACAGCAATCAACTCGAGTTGATTGCTGTACTGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013684
VALIDATED
TBP MISSION shRNA shRNA Plasmid DNA
TATA box binding protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013684.3-1416s21c1
Sequence:CCGGGGCGGCACTGCCCATTTATTTCTCGAGAAATAAATGGGCAGTGCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013684.3-1071s21c1
Sequence:CCGGCCAGAATTGTTCTCCTTATTTCTCGAGAAATAAGGAGAACAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013684.3-1020s21c1
Sequence:CCGGGTAGCTATGAGCCAGAATTATCTCGAGATAATTCTGGCTCATAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013684.3-798s21c1
Sequence:CCGGCACGGACAACTGCGTTGATTTCTCGAGAAATCAACGCAGTTGTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013684.3-678s21c1
Sequence:CCGGATATTGTATCTACCGTGAATCCTCGAGGATTCACGGTAGATACAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013684.1-790s1c1
Sequence:CCGGCCAGAATTATTTCCTGGATTACTCGAGTAATCCAGGAAATAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013684.1-675s1c1
Sequence:CCGGCCCAGCTAAGTTCTTAGACTTCTCGAGAAGTCTAAGAACTTAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013684.1-482s1c1
Sequence:CCGGCCATTGCACTTCGTGCAAGAACTCGAGTTCTTGCACGAAGTGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013684.1-81s1c1
Sequence:CCGGCTTTAGTCCAATGATGCCTTACTCGAGTAAGGCATCATTGGACTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013684.1-233s1c1
Sequence:CCGGCAGCCTCAGTACAGCAATCAACTCGAGTTGATTGCTGTACTGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013684
VALIDATED
TBP MISSION shRNA Lentiviral Transduction Particles
TATA box binding protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013684.3-1416s21c1
Sequence:CCGGGGCGGCACTGCCCATTTATTTCTCGAGAAATAAATGGGCAGTGCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013684.3-1071s21c1
Sequence:CCGGCCAGAATTGTTCTCCTTATTTCTCGAGAAATAAGGAGAACAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013684.3-1020s21c1
Sequence:CCGGGTAGCTATGAGCCAGAATTATCTCGAGATAATTCTGGCTCATAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013684.3-798s21c1
Sequence:CCGGCACGGACAACTGCGTTGATTTCTCGAGAAATCAACGCAGTTGTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013684.3-678s21c1
Sequence:CCGGATATTGTATCTACCGTGAATCCTCGAGGATTCACGGTAGATACAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013684.1-790s1c1
Sequence:CCGGCCAGAATTATTTCCTGGATTACTCGAGTAATCCAGGAAATAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013684.1-675s1c1
Sequence:CCGGCCCAGCTAAGTTCTTAGACTTCTCGAGAAGTCTAAGAACTTAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013684.1-482s1c1
Sequence:CCGGCCATTGCACTTCGTGCAAGAACTCGAGTTCTTGCACGAAGTGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013684.1-81s1c1
Sequence:CCGGCTTTAGTCCAATGATGCCTTACTCGAGTAAGGCATCATTGGACTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013684.1-233s1c1
Sequence:CCGGCAGCCTCAGTACAGCAATCAACTCGAGTTGATTGCTGTACTGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003194
VALIDATED
TBP MISSION shRNA Bacterial Glycerol Stock
TATA box binding protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003194.3-755s21c1
Sequence:GTACCGGGGTTGTAAACTTGACCTAAAGCTCGAGCTTTAGGTCAAGTTTACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003194.3-1571s21c1
Sequence:CCGGTGTTAAAGCCACCTCTATAATCTCGAGATTATAGAGGTGGCTTTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003194.3-1061s21c1
Sequence:CCGGCACCAACAATTTAGTAGTTATCTCGAGATAACTACTAAATTGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_003194.3-814s21c1
Sequence:CCGGCAAGCGGTTTGCTGCGGTAATCTCGAGATTACCGCAGCAAACCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_003194.3-789s21c1
Sequence:CCGGGTGCCCGAAACGCCGAATATACTCGAGTATATTCGGCGTTTCGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003194.2-1582s1c1
Sequence:CCGGCCTCTATAATTGATTGGACTTCTCGAGAAGTCCAATCAATTATAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_003194.2-307s1c1
Sequence:CCGGCCCTATCTTTAGTCCAATGATCTCGAGATCATTGGACTAAAGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003194.2-741s1c1
Sequence:CCGGCCACAGTGAATCTTGGTTGTACTCGAGTACAACCAAGATTCACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003194.2-1059s1c1
Sequence:CCGGCCCACCAACAATTTAGTAGTTCTCGAGAACTACTAAATTGTTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_003194.2-1084s1c1
Sequence:CCGGGCCAGAGTTATTTCCTGGTTTCTCGAGAAACCAGGAAATAACTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003194
VALIDATED
TBP MISSION shRNA shRNA Plasmid DNA
TATA box binding protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003194.3-755s21c1
Sequence:GTACCGGGGTTGTAAACTTGACCTAAAGCTCGAGCTTTAGGTCAAGTTTACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003194.3-1571s21c1
Sequence:CCGGTGTTAAAGCCACCTCTATAATCTCGAGATTATAGAGGTGGCTTTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003194.3-1061s21c1
Sequence:CCGGCACCAACAATTTAGTAGTTATCTCGAGATAACTACTAAATTGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_003194.3-814s21c1
Sequence:CCGGCAAGCGGTTTGCTGCGGTAATCTCGAGATTACCGCAGCAAACCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_003194.3-789s21c1
Sequence:CCGGGTGCCCGAAACGCCGAATATACTCGAGTATATTCGGCGTTTCGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003194.2-1582s1c1
Sequence:CCGGCCTCTATAATTGATTGGACTTCTCGAGAAGTCCAATCAATTATAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_003194.2-307s1c1
Sequence:CCGGCCCTATCTTTAGTCCAATGATCTCGAGATCATTGGACTAAAGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003194.2-741s1c1
Sequence:CCGGCCACAGTGAATCTTGGTTGTACTCGAGTACAACCAAGATTCACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003194.2-1059s1c1
Sequence:CCGGCCCACCAACAATTTAGTAGTTCTCGAGAACTACTAAATTGTTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_003194.2-1084s1c1
Sequence:CCGGGCCAGAGTTATTTCCTGGTTTCTCGAGAAACCAGGAAATAACTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003194
VALIDATED
TBP MISSION shRNA Lentiviral Transduction Particles
TATA box binding protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003194.3-755s21c1
Sequence:GTACCGGGGTTGTAAACTTGACCTAAAGCTCGAGCTTTAGGTCAAGTTTACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003194.3-1571s21c1
Sequence:CCGGTGTTAAAGCCACCTCTATAATCTCGAGATTATAGAGGTGGCTTTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003194.3-1061s21c1
Sequence:CCGGCACCAACAATTTAGTAGTTATCTCGAGATAACTACTAAATTGTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_003194.3-814s21c1
Sequence:CCGGCAAGCGGTTTGCTGCGGTAATCTCGAGATTACCGCAGCAAACCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_003194.3-789s21c1
Sequence:CCGGGTGCCCGAAACGCCGAATATACTCGAGTATATTCGGCGTTTCGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003194.2-1582s1c1
Sequence:CCGGCCTCTATAATTGATTGGACTTCTCGAGAAGTCCAATCAATTATAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_003194.2-307s1c1
Sequence:CCGGCCCTATCTTTAGTCCAATGATCTCGAGATCATTGGACTAAAGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003194.2-741s1c1
Sequence:CCGGCCACAGTGAATCTTGGTTGTACTCGAGTACAACCAAGATTCACTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003194.2-1059s1c1
Sequence:CCGGCCCACCAACAATTTAGTAGTTCTCGAGAACTACTAAATTGTTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_003194.2-1084s1c1
Sequence:CCGGGCCAGAGTTATTTCCTGGTTTCTCGAGAAACCAGGAAATAACTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks