EMAIL THIS PAGE TO A FRIEND

TBPL1

TBP-like 1

Synonyms: MGC:8389 MGC:9620 STUD TLF TLP TRF2
UniProtKB ID: P62380, A8K8F5, O95753, Q9BWD5, Q9Z2Z0
Gene ID:
Human(9519) Summary: This gene encodes a member of the TATA box-binding protein family. TATA box-binding proteins play a critical role in transcription by RNA polymerase II as components of the transcription factor IID (TFIID) complex. The encoded protein does not bind to the TATA box and initiates transcription from TATA-less promoters. This gene plays a critical role in spermatogenesis, and single nucleotide polymorphisms in this gene may be associated with male infertility. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 3. [provided by RefSeq, Nov 2011]
Mouse(237336) TATA box binding protein-like 1
Rat(689030) TBP-like 1
Zebrafish(403035) TBP-like 1
dog(476209) TBP-like 1
chicken(395517) TBP-like 1
cow(613818) TBP-like 1
sheep(101107201) TBP-like 1
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004865 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004865 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004865 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011603 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011603 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011603 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004865 Rosetta Predictions human pricing
NM_001127201 Rosetta Predictions rat pricing
NM_011603 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004865 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066377 predicted 481
2 SASI_Hs01_00066378 predicted 832
3 SASI_Hs01_00066379 predicted 822
4 SASI_Hs01_00066380 predicted 675
5 SASI_Hs01_00066381 predicted 772
6 SASI_Hs01_00066382 predicted 461
7 SASI_Hs01_00066383 predicted 622
8 SASI_Hs01_00066384 predicted 605
9 SASI_Hs01_00066385 predicted 777
10 SASI_Hs01_00066386 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127201 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253473 predicted 356
2 SASI_Rn02_00253474 predicted 825
3 SASI_Rn02_00253475 predicted 639
4 SASI_Rn02_00253476 predicted 261
5 SASI_Rn02_00253477 predicted 764
6 SASI_Rn02_00253478 predicted 459
7 SASI_Rn02_00253479 predicted 387
8 SASI_Rn02_00253480 predicted 679
9 SASI_Rn02_00253481 predicted 627
10 SASI_Rn02_00253482 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011603 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067706 predicted 641
2 SASI_Mm01_00067707 predicted 476
3 SASI_Mm01_00067709 predicted 688
4 SASI_Mm01_00067710 predicted 514
5 SASI_Mm01_00067711 predicted 314
6 SASI_Mm01_00067712 predicted 730
7 SASI_Mm01_00067713 predicted 442
8 SASI_Mm01_00067714 predicted 1052
9 SASI_Mm01_00067715 predicted 1012
10 SASI_Mm02_00321018 predicted 733
11 SASI_Mm01_00067708 predicted 407
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004865
VALIDATED
TBPL1 MISSION shRNA Bacterial Glycerol Stock
TBP-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004865.2-871s1c1
Sequence:CCGGCACCACTTAATTGGTTAGAATCTCGAGATTCTAACCAATTAAGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004865.2-629s1c1
Sequence:CCGGGTGTGTAACATGCCATTTGAACTCGAGTTCAAATGGCATGTTACACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004865.2-466s1c1
Sequence:CCGGACCTAGAATTACAGCTACAATCTCGAGATTGTAGCTGTAATTCTAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004865.2-689s1c1
Sequence:CCGGGCCAGTTACGAACCTGAACTTCTCGAGAAGTTCAGGTTCGTAACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004865.2-817s1c1
Sequence:CCGGTGTGGAACAGATTTACCCATTCTCGAGAATGGGTAAATCTGTTCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004865.2-817s21c1
Sequence:CCGGTGTGGAACAGATTTACCCATTCTCGAGAATGGGTAAATCTGTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004865.2-466s21c1
Sequence:CCGGACCTAGAATTACAGCTACAATCTCGAGATTGTAGCTGTAATTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004865.2-714s21c1
Sequence:CCGGCTGCTGTGTGCTATCGGATAACTCGAGTTATCCGATAGCACACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004865.2-1025s21c1
Sequence:CCGGCCAAACCTTGCTGTAATATAACTCGAGTTATATTACAGCAAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004865.2-522s21c1
Sequence:CCGGCAAGTGAAGAAGAAGCTAAATCTCGAGATTTAGCTTCTTCTTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004865
VALIDATED
TBPL1 MISSION shRNA shRNA Plasmid DNA
TBP-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004865.2-871s1c1
Sequence:CCGGCACCACTTAATTGGTTAGAATCTCGAGATTCTAACCAATTAAGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004865.2-629s1c1
Sequence:CCGGGTGTGTAACATGCCATTTGAACTCGAGTTCAAATGGCATGTTACACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004865.2-466s1c1
Sequence:CCGGACCTAGAATTACAGCTACAATCTCGAGATTGTAGCTGTAATTCTAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004865.2-689s1c1
Sequence:CCGGGCCAGTTACGAACCTGAACTTCTCGAGAAGTTCAGGTTCGTAACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004865.2-817s1c1
Sequence:CCGGTGTGGAACAGATTTACCCATTCTCGAGAATGGGTAAATCTGTTCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004865.2-817s21c1
Sequence:CCGGTGTGGAACAGATTTACCCATTCTCGAGAATGGGTAAATCTGTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004865.2-466s21c1
Sequence:CCGGACCTAGAATTACAGCTACAATCTCGAGATTGTAGCTGTAATTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004865.2-714s21c1
Sequence:CCGGCTGCTGTGTGCTATCGGATAACTCGAGTTATCCGATAGCACACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004865.2-1025s21c1
Sequence:CCGGCCAAACCTTGCTGTAATATAACTCGAGTTATATTACAGCAAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004865.2-522s21c1
Sequence:CCGGCAAGTGAAGAAGAAGCTAAATCTCGAGATTTAGCTTCTTCTTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004865
VALIDATED
TBPL1 MISSION shRNA Lentiviral Transduction Particles
TBP-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004865.2-871s1c1
Sequence:CCGGCACCACTTAATTGGTTAGAATCTCGAGATTCTAACCAATTAAGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004865.2-629s1c1
Sequence:CCGGGTGTGTAACATGCCATTTGAACTCGAGTTCAAATGGCATGTTACACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004865.2-466s1c1
Sequence:CCGGACCTAGAATTACAGCTACAATCTCGAGATTGTAGCTGTAATTCTAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004865.2-689s1c1
Sequence:CCGGGCCAGTTACGAACCTGAACTTCTCGAGAAGTTCAGGTTCGTAACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004865.2-817s1c1
Sequence:CCGGTGTGGAACAGATTTACCCATTCTCGAGAATGGGTAAATCTGTTCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004865.2-817s21c1
Sequence:CCGGTGTGGAACAGATTTACCCATTCTCGAGAATGGGTAAATCTGTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004865.2-466s21c1
Sequence:CCGGACCTAGAATTACAGCTACAATCTCGAGATTGTAGCTGTAATTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004865.2-714s21c1
Sequence:CCGGCTGCTGTGTGCTATCGGATAACTCGAGTTATCCGATAGCACACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004865.2-1025s21c1
Sequence:CCGGCCAAACCTTGCTGTAATATAACTCGAGTTATATTACAGCAAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004865.2-522s21c1
Sequence:CCGGCAAGTGAAGAAGAAGCTAAATCTCGAGATTTAGCTTCTTCTTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011603
VALIDATED
TBPL1 MISSION shRNA Bacterial Glycerol Stock
TBP-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011603.2-2313s1c1
Sequence:CCGGCCCATAATTCATTGTGACTTTCTCGAGAAAGTCACAATGAATTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011603.2-648s1c1
Sequence:CCGGAGATCCGTTTGCCAGAATTTACTCGAGTAAATTCTGGCAAACGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011603.2-467s1c1
Sequence:CCGGCCTAGAATTACAGCTACAATTCTCGAGAATTGTAGCTGTAATTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011603.2-626s1c1
Sequence:CCGGGCAGTGTGTAACATGCCCTTTCTCGAGAAAGGGCATGTTACACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011603.2-723s1c1
Sequence:CCGGGCTATCGGATAAAGTCTCTAACTCGAGTTAGAGACTTTATCCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011603.5-498s21c1
Sequence:CCGGGCGTGATGTTGGGAAAGTATTCTCGAGAATACTTTCCCAACATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011603.5-1310s21c1
Sequence:CCGGGGGCACCAAAGAACCTGTAAACTCGAGTTTACAGGTTCTTTGGTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011603.5-791s21c1
Sequence:CCGGGCTATCGGATAAAGTCTCTAACTCGAGTTAGAGACTTTATCCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011603.5-716s21c1
Sequence:CCGGAGATCCGTTTGCCAGAATTTACTCGAGTAAATTCTGGCAAACGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011603.5-535s21c1
Sequence:CCGGCCTAGAATTACAGCTACAATTCTCGAGAATTGTAGCTGTAATTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011603
VALIDATED
TBPL1 MISSION shRNA shRNA Plasmid DNA
TBP-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011603.2-2313s1c1
Sequence:CCGGCCCATAATTCATTGTGACTTTCTCGAGAAAGTCACAATGAATTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011603.2-648s1c1
Sequence:CCGGAGATCCGTTTGCCAGAATTTACTCGAGTAAATTCTGGCAAACGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011603.2-467s1c1
Sequence:CCGGCCTAGAATTACAGCTACAATTCTCGAGAATTGTAGCTGTAATTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011603.2-626s1c1
Sequence:CCGGGCAGTGTGTAACATGCCCTTTCTCGAGAAAGGGCATGTTACACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011603.2-723s1c1
Sequence:CCGGGCTATCGGATAAAGTCTCTAACTCGAGTTAGAGACTTTATCCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011603.5-498s21c1
Sequence:CCGGGCGTGATGTTGGGAAAGTATTCTCGAGAATACTTTCCCAACATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011603.5-1310s21c1
Sequence:CCGGGGGCACCAAAGAACCTGTAAACTCGAGTTTACAGGTTCTTTGGTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011603.5-791s21c1
Sequence:CCGGGCTATCGGATAAAGTCTCTAACTCGAGTTAGAGACTTTATCCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011603.5-716s21c1
Sequence:CCGGAGATCCGTTTGCCAGAATTTACTCGAGTAAATTCTGGCAAACGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011603.5-535s21c1
Sequence:CCGGCCTAGAATTACAGCTACAATTCTCGAGAATTGTAGCTGTAATTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011603
VALIDATED
TBPL1 MISSION shRNA Lentiviral Transduction Particles
TBP-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011603.2-2313s1c1
Sequence:CCGGCCCATAATTCATTGTGACTTTCTCGAGAAAGTCACAATGAATTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011603.2-648s1c1
Sequence:CCGGAGATCCGTTTGCCAGAATTTACTCGAGTAAATTCTGGCAAACGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011603.2-467s1c1
Sequence:CCGGCCTAGAATTACAGCTACAATTCTCGAGAATTGTAGCTGTAATTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011603.2-626s1c1
Sequence:CCGGGCAGTGTGTAACATGCCCTTTCTCGAGAAAGGGCATGTTACACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011603.2-723s1c1
Sequence:CCGGGCTATCGGATAAAGTCTCTAACTCGAGTTAGAGACTTTATCCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011603.5-498s21c1
Sequence:CCGGGCGTGATGTTGGGAAAGTATTCTCGAGAATACTTTCCCAACATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011603.5-1310s21c1
Sequence:CCGGGGGCACCAAAGAACCTGTAAACTCGAGTTTACAGGTTCTTTGGTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011603.5-791s21c1
Sequence:CCGGGCTATCGGATAAAGTCTCTAACTCGAGTTAGAGACTTTATCCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011603.5-716s21c1
Sequence:CCGGAGATCCGTTTGCCAGAATTTACTCGAGTAAATTCTGGCAAACGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011603.5-535s21c1
Sequence:CCGGCCTAGAATTACAGCTACAATTCTCGAGAATTGTAGCTGTAATTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks