EMAIL THIS PAGE TO A FRIEND

TBPL2

TATA box binding protein like 2

Synonyms: TBP2 TRF3
UniProtKB ID: Q6SJ96, Q17RU8
Gene ID:
Mouse(227606) TATA box binding protein like 2
Rat(680050) TATA box binding protein-like 2
cow(615096) TATA box binding protein like 2
sheep(101113500) TATA box binding protein like 2
naked mole-rat(101724326) TATA box binding protein like 2
domestic guinea pig(100726569) TATA box binding protein like 2
Zebrafish(407713) TATA box binding protein like 2
domestic cat(101093111) TATA box binding protein like 2
dog(611011) TATA box binding protein like 2
chicken(776269) TATA box binding protein like 2
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0107 AQUA Peptide FLDF[K] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, rat pricing
AQ0114 AQUA Peptide TTALIFSSG[K] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199047 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199047 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199047 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199059 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199059 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199059 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199047 Rosetta Predictions human pricing
NM_001099361 Rosetta Predictions rat pricing
NM_199059 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145643 predicted 442
2 SASI_Hs01_00145644 predicted 872
3 SASI_Hs01_00145645 predicted 1002
4 SASI_Hs01_00145646 predicted 672
5 SASI_Hs01_00145647 predicted 584
6 SASI_Hs01_00145648 predicted 979
7 SASI_Hs01_00145649 predicted 340
8 SASI_Hs01_00145650 predicted 732
9 SASI_Hs01_00145651 predicted 1011
10 SASI_Hs02_00372539 predicted 952
11 SASI_Hs01_00145652 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099361 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209221 predicted 466
2 SASI_Rn02_00209222 predicted 487
3 SASI_Rn02_00209223 predicted 281
4 SASI_Rn02_00209224 predicted 509
5 SASI_Rn02_00209225 predicted 442
6 SASI_Rn02_00209226 predicted 203
7 SASI_Rn02_00209227 predicted 377
8 SASI_Rn02_00209228 predicted 367
9 SASI_Rn02_00209229 predicted 499
10 SASI_Rn02_00209230 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351336 predicted 858
2 SASI_Mm01_00154855 predicted 310
3 SASI_Mm01_00154856 predicted 484
4 SASI_Mm01_00154857 predicted 562
5 SASI_Mm02_00351337 predicted 666
6 SASI_Mm01_00154858 predicted 710
7 SASI_Mm01_00154860 predicted 955
8 SASI_Mm01_00154862 predicted 565
9 SASI_Mm02_00351338 predicted 282
10 SASI_Mm01_00154863 predicted 274
11 SASI_Mm01_00154854 predicted 963
12 SASI_Mm01_00154859 predicted 999
13 SASI_Mm01_00154861 predicted 998
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199047
TBPL2 MISSION shRNA Bacterial Glycerol Stock
TATA box binding protein like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199047.2-609s21c1
Sequence:CCGGGAATATAGTTTCCACTGTAAACTCGAGTTTACAGTGGAAACTATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199047.2-181s21c1
Sequence:CCGGTTCAGCCCAGTTGTACCTTATCTCGAGATAAGGTACAACTGGGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199047.2-223s21c1
Sequence:CCGGTCCAATCCGGATACTGCATTTCTCGAGAAATGCAGTATCCGGATTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199047.1-248s1c1
Sequence:CCGGCGAACCCTGAAGTCAAAGAAACTCGAGTTTCTTTGACTTCAGGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199047.1-731s1c1
Sequence:CCGGCCAGGACAACAGCCCTTATATCTCGAGATATAAGGGCTGTTGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199047.1-513s1c1
Sequence:CCGGGAAACCAAACTCCGACTCCTTCTCGAGAAGGAGTCGGAGTTTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199047.1-798s1c1
Sequence:CCGGGTCTCGACTTGCAGCAAGAAACTCGAGTTTCTTGCTGCAAGTCGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199047.1-339s1c1
Sequence:CCGGGCCTGTCATTAGCAAACACGACTCGAGTCGTGTTTGCTAATGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199047
TBPL2 MISSION shRNA shRNA Plasmid DNA
TATA box binding protein like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199047.2-609s21c1
Sequence:CCGGGAATATAGTTTCCACTGTAAACTCGAGTTTACAGTGGAAACTATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199047.2-181s21c1
Sequence:CCGGTTCAGCCCAGTTGTACCTTATCTCGAGATAAGGTACAACTGGGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199047.2-223s21c1
Sequence:CCGGTCCAATCCGGATACTGCATTTCTCGAGAAATGCAGTATCCGGATTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199047.1-248s1c1
Sequence:CCGGCGAACCCTGAAGTCAAAGAAACTCGAGTTTCTTTGACTTCAGGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199047.1-731s1c1
Sequence:CCGGCCAGGACAACAGCCCTTATATCTCGAGATATAAGGGCTGTTGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199047.1-513s1c1
Sequence:CCGGGAAACCAAACTCCGACTCCTTCTCGAGAAGGAGTCGGAGTTTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199047.1-798s1c1
Sequence:CCGGGTCTCGACTTGCAGCAAGAAACTCGAGTTTCTTGCTGCAAGTCGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199047.1-339s1c1
Sequence:CCGGGCCTGTCATTAGCAAACACGACTCGAGTCGTGTTTGCTAATGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199047
TBPL2 MISSION shRNA Lentiviral Transduction Particles
TATA box binding protein like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199047.2-609s21c1
Sequence:CCGGGAATATAGTTTCCACTGTAAACTCGAGTTTACAGTGGAAACTATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199047.2-181s21c1
Sequence:CCGGTTCAGCCCAGTTGTACCTTATCTCGAGATAAGGTACAACTGGGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199047.2-223s21c1
Sequence:CCGGTCCAATCCGGATACTGCATTTCTCGAGAAATGCAGTATCCGGATTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199047.1-248s1c1
Sequence:CCGGCGAACCCTGAAGTCAAAGAAACTCGAGTTTCTTTGACTTCAGGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199047.1-731s1c1
Sequence:CCGGCCAGGACAACAGCCCTTATATCTCGAGATATAAGGGCTGTTGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199047.1-513s1c1
Sequence:CCGGGAAACCAAACTCCGACTCCTTCTCGAGAAGGAGTCGGAGTTTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199047.1-798s1c1
Sequence:CCGGGTCTCGACTTGCAGCAAGAAACTCGAGTTTCTTGCTGCAAGTCGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199047.1-339s1c1
Sequence:CCGGGCCTGTCATTAGCAAACACGACTCGAGTCGTGTTTGCTAATGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199059
TBPL2 MISSION shRNA Bacterial Glycerol Stock
TATA box binding protein like 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199059.1-512s21c1
Sequence:CCGGCCTTACCTGTGGCATTGATAGCTCGAGCTATCAATGCCACAGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199059.1-1045s21c1
Sequence:CCGGGAGCGTTCTGAGATCTATGAACTCGAGTTCATAGATCTCAGAACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199059.1-677s21c1
Sequence:CCGGAGAGGTTTGCTGCAGTAATAACTCGAGTTATTACTGCAGCAAACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199059.1-1122s1c1
Sequence:CCGGCTGGGCTTCAAGCAATAATTTCTCGAGAAATTATTGCTTGAAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199059.1-175s1c1
Sequence:CCGGCCTTTAGACATGCACTCACTTCTCGAGAAGTGAGTGCATGTCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199059.1-616s1c1
Sequence:CCGGGCCTGTAAATTGGATCTGAGACTCGAGTCTCAGATCCAATTTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199059.1-925s1c1
Sequence:CCGGCGGCAGTTCAGTAGCAGTTATCTCGAGATAACTGCTACTGAACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199059.1-580s1c1
Sequence:CCGGCCTCAATTACAGAATGTAGTTCTCGAGAACTACATTCTGTAATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199059
TBPL2 MISSION shRNA shRNA Plasmid DNA
TATA box binding protein like 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199059.1-512s21c1
Sequence:CCGGCCTTACCTGTGGCATTGATAGCTCGAGCTATCAATGCCACAGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199059.1-1045s21c1
Sequence:CCGGGAGCGTTCTGAGATCTATGAACTCGAGTTCATAGATCTCAGAACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199059.1-677s21c1
Sequence:CCGGAGAGGTTTGCTGCAGTAATAACTCGAGTTATTACTGCAGCAAACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199059.1-1122s1c1
Sequence:CCGGCTGGGCTTCAAGCAATAATTTCTCGAGAAATTATTGCTTGAAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199059.1-175s1c1
Sequence:CCGGCCTTTAGACATGCACTCACTTCTCGAGAAGTGAGTGCATGTCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199059.1-616s1c1
Sequence:CCGGGCCTGTAAATTGGATCTGAGACTCGAGTCTCAGATCCAATTTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199059.1-925s1c1
Sequence:CCGGCGGCAGTTCAGTAGCAGTTATCTCGAGATAACTGCTACTGAACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199059.1-580s1c1
Sequence:CCGGCCTCAATTACAGAATGTAGTTCTCGAGAACTACATTCTGTAATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199059
TBPL2 MISSION shRNA Lentiviral Transduction Particles
TATA box binding protein like 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199059.1-512s21c1
Sequence:CCGGCCTTACCTGTGGCATTGATAGCTCGAGCTATCAATGCCACAGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199059.1-1045s21c1
Sequence:CCGGGAGCGTTCTGAGATCTATGAACTCGAGTTCATAGATCTCAGAACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199059.1-677s21c1
Sequence:CCGGAGAGGTTTGCTGCAGTAATAACTCGAGTTATTACTGCAGCAAACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199059.1-1122s1c1
Sequence:CCGGCTGGGCTTCAAGCAATAATTTCTCGAGAAATTATTGCTTGAAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199059.1-175s1c1
Sequence:CCGGCCTTTAGACATGCACTCACTTCTCGAGAAGTGAGTGCATGTCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199059.1-616s1c1
Sequence:CCGGGCCTGTAAATTGGATCTGAGACTCGAGTCTCAGATCCAATTTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199059.1-925s1c1
Sequence:CCGGCGGCAGTTCAGTAGCAGTTATCTCGAGATAACTGCTACTGAACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199059.1-580s1c1
Sequence:CCGGCCTCAATTACAGAATGTAGTTCTCGAGAACTACATTCTGTAATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks