EMAIL THIS PAGE TO A FRIEND

TBR1

T-box, brain, 1

Synonyms: TBR-1 TES-56
UniProtKB ID: Q16650, Q14DC5, Q53TH0
Gene ID:
Human(10716) Summary: This gene is a member of a conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. A similar protein has been disrupted in mice and shown to be critical for early cortical development, and causes loss of projection neurons in the olfactory bulbs and olfactory cortex. The C-terminal region this similar protein was found to be necessary and sufficient for association with the guanylate kinase domain of calcium/calmodulin-dependent serine protein kinase. [provided by RefSeq, Jul 2008]
Mouse(21375) T-box brain gene 1
Rat(680427) T-box, brain, 1
chicken(429029) T-box, brain, 1
dog(488370) T-box, brain, 1
Horse(100061032) T-box, brain, 1
domestic cat(101096826) T-box, brain, 1
cow(505142) T-box, brain, 1
sheep(101110826) T-box, brain, 1
naked mole-rat(101696910) T-box, brain, 1
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009322 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009322 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009322 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006593 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006593 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006593 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006593 Rosetta Predictions human pricing
XM_001056898 Rosetta Predictions rat pricing
NM_009322 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098787 predicted 1182
2 SASI_Hs01_00098788 predicted 1028
3 SASI_Hs01_00098789 predicted 1031
4 SASI_Hs01_00098790 predicted 1412
5 SASI_Hs01_00098791 predicted 1946
6 SASI_Hs01_00098792 predicted 1308
7 SASI_Hs01_00098793 predicted 425
8 SASI_Hs01_00098794 predicted 473
9 SASI_Hs01_00098795 predicted 480
10 SASI_Hs01_00098796 predicted 2132
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056898 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284810 predicted 879
2 SASI_Rn02_00284811 predicted 1426
3 SASI_Rn02_00284812 predicted 882
4 SASI_Rn02_00284813 predicted 1022
5 SASI_Rn02_00284814 predicted 863
6 SASI_Rn02_00284815 predicted 1429
7 SASI_Rn02_00284816 predicted 966
8 SASI_Rn02_00284817 predicted 976
9 SASI_Rn02_00284818 predicted 1238
10 SASI_Rn02_00284819 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009322 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183380 predicted 1140
2 SASI_Mm01_00183381 predicted 976
3 SASI_Mm01_00183382 predicted 339
4 SASI_Mm01_00183383 predicted 1427
5 SASI_Mm01_00183384 predicted 705
6 SASI_Mm01_00183386 predicted 888
7 SASI_Mm01_00183387 predicted 424
8 SASI_Mm02_00315867 predicted 1905
9 SASI_Mm01_00183388 predicted 1484
10 SASI_Mm01_00183389 predicted 430
11 SASI_Mm01_00183385 predicted 332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009322
TBR1 MISSION shRNA Bacterial Glycerol Stock
T-box, brain, 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009322.2-1377s1c1
Sequence:CCGGCACGGATATTACACAACTAAACTCGAGTTTAGTTGTGTAATATCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009322.2-1033s1c1
Sequence:CCGGGATCCCAATCACTGGAGGTTTCTCGAGAAACCTCCAGTGATTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009322.2-2108s1c1
Sequence:CCGGCCTCCATCAAATCCATCGACTCTCGAGAGTCGATGGATTTGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009322.2-885s1c1
Sequence:CCGGCAGGCCACTTTGGCTGAAATTCTCGAGAATTTCAGCCAAAGTGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009322.2-992s1c1
Sequence:CCGGCCACCGCTCATTACAATATTTCTCGAGAAATATTGTAATGAGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009322.3-1367s21c1
Sequence:CCGGCCTACCAGAACACGGATATTACTCGAGTAATATCCGTGTTCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009322.3-1098s21c1
Sequence:CCGGGCAAGGAAACCGGGTCTATATCTCGAGATATAGACCCGGTTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009322.3-984s21c1
Sequence:CCGGTCTCGATCCCACCGCTCATTACTCGAGTAATGAGCGGTGGGATCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009322.3-2701s21c1
Sequence:CCGGTTGTCTTGGCCTCCCTATTTACTCGAGTAAATAGGGAGGCCAAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009322.3-2099s21c1
Sequence:CCGGAGACGCCCTCCTCCATCAAATCTCGAGATTTGATGGAGGAGGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009322
TBR1 MISSION shRNA shRNA Plasmid DNA
T-box, brain, 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009322.2-1377s1c1
Sequence:CCGGCACGGATATTACACAACTAAACTCGAGTTTAGTTGTGTAATATCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009322.2-1033s1c1
Sequence:CCGGGATCCCAATCACTGGAGGTTTCTCGAGAAACCTCCAGTGATTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009322.2-2108s1c1
Sequence:CCGGCCTCCATCAAATCCATCGACTCTCGAGAGTCGATGGATTTGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009322.2-885s1c1
Sequence:CCGGCAGGCCACTTTGGCTGAAATTCTCGAGAATTTCAGCCAAAGTGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009322.2-992s1c1
Sequence:CCGGCCACCGCTCATTACAATATTTCTCGAGAAATATTGTAATGAGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009322.3-1367s21c1
Sequence:CCGGCCTACCAGAACACGGATATTACTCGAGTAATATCCGTGTTCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009322.3-1098s21c1
Sequence:CCGGGCAAGGAAACCGGGTCTATATCTCGAGATATAGACCCGGTTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009322.3-984s21c1
Sequence:CCGGTCTCGATCCCACCGCTCATTACTCGAGTAATGAGCGGTGGGATCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009322.3-2701s21c1
Sequence:CCGGTTGTCTTGGCCTCCCTATTTACTCGAGTAAATAGGGAGGCCAAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009322.3-2099s21c1
Sequence:CCGGAGACGCCCTCCTCCATCAAATCTCGAGATTTGATGGAGGAGGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009322
TBR1 MISSION shRNA Lentiviral Transduction Particles
T-box, brain, 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009322.2-1377s1c1
Sequence:CCGGCACGGATATTACACAACTAAACTCGAGTTTAGTTGTGTAATATCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009322.2-1033s1c1
Sequence:CCGGGATCCCAATCACTGGAGGTTTCTCGAGAAACCTCCAGTGATTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009322.2-2108s1c1
Sequence:CCGGCCTCCATCAAATCCATCGACTCTCGAGAGTCGATGGATTTGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009322.2-885s1c1
Sequence:CCGGCAGGCCACTTTGGCTGAAATTCTCGAGAATTTCAGCCAAAGTGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009322.2-992s1c1
Sequence:CCGGCCACCGCTCATTACAATATTTCTCGAGAAATATTGTAATGAGCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009322.3-1367s21c1
Sequence:CCGGCCTACCAGAACACGGATATTACTCGAGTAATATCCGTGTTCTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009322.3-1098s21c1
Sequence:CCGGGCAAGGAAACCGGGTCTATATCTCGAGATATAGACCCGGTTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009322.3-984s21c1
Sequence:CCGGTCTCGATCCCACCGCTCATTACTCGAGTAATGAGCGGTGGGATCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009322.3-2701s21c1
Sequence:CCGGTTGTCTTGGCCTCCCTATTTACTCGAGTAAATAGGGAGGCCAAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009322.3-2099s21c1
Sequence:CCGGAGACGCCCTCCTCCATCAAATCTCGAGATTTGATGGAGGAGGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006593
TBR1 MISSION shRNA Bacterial Glycerol Stock
T-box, brain, 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006593.2-2554s1c1
Sequence:CCGGCCGACCTTCAACTTTGCTGTACTCGAGTACAGCAAAGTTGAAGGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006593.2-338s1c1
Sequence:CCGGGCTCTCCAAGAAATTTCTCAACTCGAGTTGAGAAATTTCTTGGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006593.2-485s1c1
Sequence:CCGGTCAGTCAGATACAGACAATTTCTCGAGAAATTGTCTGTATCTGACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006593.2-1145s1c1
Sequence:CCGGGCAAGGAAATCGGGTCTATATCTCGAGATATAGACCCGATTTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006593.2-1039s1c1
Sequence:CCGGCCACGGCTCATTACAATATTTCTCGAGAAATATTGTAATGAGCCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006593.2-402s21c1
Sequence:CCGGTTGCACGATCATCCCATTATCCTCGAGGATAATGGGATGATCGTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006593.2-2608s21c1
Sequence:CCGGTGGAGTTATCCTCCTACAATTCTCGAGAATTGTAGGAGGATAACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006593
TBR1 MISSION shRNA shRNA Plasmid DNA
T-box, brain, 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006593.2-2554s1c1
Sequence:CCGGCCGACCTTCAACTTTGCTGTACTCGAGTACAGCAAAGTTGAAGGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006593.2-338s1c1
Sequence:CCGGGCTCTCCAAGAAATTTCTCAACTCGAGTTGAGAAATTTCTTGGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006593.2-485s1c1
Sequence:CCGGTCAGTCAGATACAGACAATTTCTCGAGAAATTGTCTGTATCTGACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006593.2-1145s1c1
Sequence:CCGGGCAAGGAAATCGGGTCTATATCTCGAGATATAGACCCGATTTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006593.2-1039s1c1
Sequence:CCGGCCACGGCTCATTACAATATTTCTCGAGAAATATTGTAATGAGCCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006593.2-402s21c1
Sequence:CCGGTTGCACGATCATCCCATTATCCTCGAGGATAATGGGATGATCGTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006593.2-2608s21c1
Sequence:CCGGTGGAGTTATCCTCCTACAATTCTCGAGAATTGTAGGAGGATAACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006593
TBR1 MISSION shRNA Lentiviral Transduction Particles
T-box, brain, 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006593.2-2554s1c1
Sequence:CCGGCCGACCTTCAACTTTGCTGTACTCGAGTACAGCAAAGTTGAAGGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006593.2-338s1c1
Sequence:CCGGGCTCTCCAAGAAATTTCTCAACTCGAGTTGAGAAATTTCTTGGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006593.2-485s1c1
Sequence:CCGGTCAGTCAGATACAGACAATTTCTCGAGAAATTGTCTGTATCTGACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006593.2-1145s1c1
Sequence:CCGGGCAAGGAAATCGGGTCTATATCTCGAGATATAGACCCGATTTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006593.2-1039s1c1
Sequence:CCGGCCACGGCTCATTACAATATTTCTCGAGAAATATTGTAATGAGCCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006593.2-402s21c1
Sequence:CCGGTTGCACGATCATCCCATTATCCTCGAGGATAATGGGATGATCGTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006593.2-2608s21c1
Sequence:CCGGTGGAGTTATCCTCCTACAATTCTCGAGAATTGTAGGAGGATAACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks