EMAIL THIS PAGE TO A FRIEND

TBRG1

transforming growth factor beta regulator 1

Synonyms: NIAM TB-5
Gene ID:
Mouse(21376) transforming growth factor beta regulated gene 1
Rat(300521) transforming growth factor beta regulator 1
Zebrafish(573117) transforming growth factor beta regulator 1
dog(489312) transforming growth factor beta regulator 1
Horse(100064183) transforming growth factor beta regulator 1
domestic cat(101101502) transforming growth factor beta regulator 1
naked mole-rat(101706153) transforming growth factor beta regulator 1
domestic guinea pig(100723281) transforming growth factor beta regulator 1
cow(507460) transforming growth factor beta regulator 1
sheep(101107235) transforming growth factor beta regulator 1
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032811 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032811 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032811 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025289 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025289 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025289 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032811 Rosetta Predictions human pricing
NR_016021 Rosetta Predictions human pricing
NM_001009344 Rosetta Predictions rat pricing
NM_025289 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076239 predicted 1180
2 SASI_Hs01_00076240 predicted 1386
3 SASI_Hs01_00076241 predicted 1393
4 SASI_Hs01_00076242 predicted 1259
5 SASI_Hs01_00076245 predicted 1037
6 SASI_Hs02_00360381 predicted 925
7 SASI_Hs01_00076247 predicted 1376
8 SASI_Hs02_00360382 predicted 930
9 SASI_Hs01_00076248 predicted 1385
10 SASI_Hs02_00360383 predicted 1506
11 SASI_Hs01_00076243 predicted 1319
12 SASI_Hs01_00076244 predicted 1106
13 SASI_Hs01_00076246 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_016021 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381436 predicted 1036
2 SASI_Hs02_00381437 predicted 1257
3 SASI_Hs02_00381438 predicted 1117
4 SASI_Hs02_00381439 predicted 904
5 SASI_Hs02_00381440 predicted 742
6 SASI_Hs02_00381441 predicted 2616
7 SASI_Hs02_00381442 predicted 789
8 SASI_Hs02_00381443 predicted 1240
9 SASI_Hs02_00381444 predicted 2594
10 SASI_Hs02_00381445 predicted 2563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080084 predicted 964
2 SASI_Rn01_00080085 predicted 247
3 SASI_Rn01_00080086 predicted 975
4 SASI_Rn01_00080087 predicted 750
5 SASI_Rn02_00199514 predicted 682
6 SASI_Rn01_00080088 predicted 741
7 SASI_Rn01_00080089 predicted 861
8 SASI_Rn01_00080090 predicted 718
9 SASI_Rn01_00080092 predicted 1056
10 SASI_Rn01_00080093 predicted 982
11 SASI_Rn01_00080091 predicted 1191
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025289 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183846 predicted 1103
2 SASI_Mm01_00183847 predicted 409
3 SASI_Mm01_00183848 predicted 1002
4 SASI_Mm01_00183849 predicted 888
5 SASI_Mm01_00183850 predicted 1070
6 SASI_Mm01_00183851 predicted 382
7 SASI_Mm01_00183852 predicted 1276
8 SASI_Mm02_00327904 predicted 1099
9 SASI_Mm01_00183853 predicted 552
10 SASI_Mm01_00183855 predicted 1172
11 SASI_Mm01_00183854 predicted 1222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032811
TBRG1 MISSION shRNA Bacterial Glycerol Stock
transforming growth factor beta regulator 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032811.2-1688s21c1
Sequence:CCGGATCTTGTAATCGGGATGTAATCTCGAGATTACATCCCGATTACAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032811.2-883s21c1
Sequence:CCGGCTATTGCAGTACTCGAATATACTCGAGTATATTCGAGTACTGCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032811.2-582s21c1
Sequence:CCGGTACAGGGAGCTGGGCCTATTTCTCGAGAAATAGGCCCAGCTCCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032811.1-1216s1c1
Sequence:CCGGCCCATGTACCTGACACATGAACTCGAGTTCATGTGTCAGGTACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032811.1-862s1c1
Sequence:CCGGGCAGATGCTTGTCATGCAGAACTCGAGTTCTGCATGACAAGCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032811.1-594s1c1
Sequence:CCGGGAGGAACCATTTGGGAAGAAACTCGAGTTTCTTCCCAAATGGTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032811.1-645s1c1
Sequence:CCGGGAGAACAACAAACTGGAAGATCTCGAGATCTTCCAGTTTGTTGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032811.1-754s1c1
Sequence:CCGGCCAGACCAGAAGTGTCTATATCTCGAGATATAGACACTTCTGGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032811
TBRG1 MISSION shRNA shRNA Plasmid DNA
transforming growth factor beta regulator 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032811.2-1688s21c1
Sequence:CCGGATCTTGTAATCGGGATGTAATCTCGAGATTACATCCCGATTACAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032811.2-883s21c1
Sequence:CCGGCTATTGCAGTACTCGAATATACTCGAGTATATTCGAGTACTGCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032811.2-582s21c1
Sequence:CCGGTACAGGGAGCTGGGCCTATTTCTCGAGAAATAGGCCCAGCTCCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032811.1-1216s1c1
Sequence:CCGGCCCATGTACCTGACACATGAACTCGAGTTCATGTGTCAGGTACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032811.1-862s1c1
Sequence:CCGGGCAGATGCTTGTCATGCAGAACTCGAGTTCTGCATGACAAGCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032811.1-594s1c1
Sequence:CCGGGAGGAACCATTTGGGAAGAAACTCGAGTTTCTTCCCAAATGGTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032811.1-645s1c1
Sequence:CCGGGAGAACAACAAACTGGAAGATCTCGAGATCTTCCAGTTTGTTGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032811.1-754s1c1
Sequence:CCGGCCAGACCAGAAGTGTCTATATCTCGAGATATAGACACTTCTGGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032811
TBRG1 MISSION shRNA Lentiviral Transduction Particles
transforming growth factor beta regulator 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032811.2-1688s21c1
Sequence:CCGGATCTTGTAATCGGGATGTAATCTCGAGATTACATCCCGATTACAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032811.2-883s21c1
Sequence:CCGGCTATTGCAGTACTCGAATATACTCGAGTATATTCGAGTACTGCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032811.2-582s21c1
Sequence:CCGGTACAGGGAGCTGGGCCTATTTCTCGAGAAATAGGCCCAGCTCCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032811.1-1216s1c1
Sequence:CCGGCCCATGTACCTGACACATGAACTCGAGTTCATGTGTCAGGTACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032811.1-862s1c1
Sequence:CCGGGCAGATGCTTGTCATGCAGAACTCGAGTTCTGCATGACAAGCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032811.1-594s1c1
Sequence:CCGGGAGGAACCATTTGGGAAGAAACTCGAGTTTCTTCCCAAATGGTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032811.1-645s1c1
Sequence:CCGGGAGAACAACAAACTGGAAGATCTCGAGATCTTCCAGTTTGTTGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032811.1-754s1c1
Sequence:CCGGCCAGACCAGAAGTGTCTATATCTCGAGATATAGACACTTCTGGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025289
VALIDATED
TBRG1 MISSION shRNA Bacterial Glycerol Stock
transforming growth factor beta regulator 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025289.3-950s21c1
Sequence:CCGGCCTGTTATGAAGAACTGCTCACTCGAGTGAGCAGTTCTTCATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025289.3-1161s21c1
Sequence:CCGGGCCAGAGAATGATGCAACTATCTCGAGATAGTTGCATCATTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025289.3-539s21c1
Sequence:CCGGAGGAACCATTTGCGAAGAAATCTCGAGATTTCTTCGCAAATGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025289.3-1409s21c1
Sequence:CCGGCCCTGCCTTCTCCTCATTATGCTCGAGCATAATGAGGAGAAGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025289.3-1098s21c1
Sequence:CCGGCAATTACCAGTGGGTGAAATTCTCGAGAATTTCACCCACTGGTAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025289.1-1074s1c1
Sequence:CCGGGCCAGAGAATGATGCAACTATCTCGAGATAGTTGCATCATTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025289.1-291s1c1
Sequence:CCGGAGAAAGAAGATACTTGCTGAACTCGAGTTCAGCAAGTATCTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025289.1-748s1c1
Sequence:CCGGCCAGACCAGAAGTGTCTGTATCTCGAGATACAGACACTTCTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025289.1-723s1c1
Sequence:CCGGCCGAGTGTATGCTAGCATGAACTCGAGTTCATGCTAGCATACACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025289.1-863s1c1
Sequence:CCGGCCTGTTATGAAGAACTGCTCACTCGAGTGAGCAGTTCTTCATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025289
VALIDATED
TBRG1 MISSION shRNA shRNA Plasmid DNA
transforming growth factor beta regulator 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025289.3-950s21c1
Sequence:CCGGCCTGTTATGAAGAACTGCTCACTCGAGTGAGCAGTTCTTCATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025289.3-1161s21c1
Sequence:CCGGGCCAGAGAATGATGCAACTATCTCGAGATAGTTGCATCATTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025289.3-539s21c1
Sequence:CCGGAGGAACCATTTGCGAAGAAATCTCGAGATTTCTTCGCAAATGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025289.3-1409s21c1
Sequence:CCGGCCCTGCCTTCTCCTCATTATGCTCGAGCATAATGAGGAGAAGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025289.3-1098s21c1
Sequence:CCGGCAATTACCAGTGGGTGAAATTCTCGAGAATTTCACCCACTGGTAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025289.1-1074s1c1
Sequence:CCGGGCCAGAGAATGATGCAACTATCTCGAGATAGTTGCATCATTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025289.1-291s1c1
Sequence:CCGGAGAAAGAAGATACTTGCTGAACTCGAGTTCAGCAAGTATCTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025289.1-748s1c1
Sequence:CCGGCCAGACCAGAAGTGTCTGTATCTCGAGATACAGACACTTCTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025289.1-723s1c1
Sequence:CCGGCCGAGTGTATGCTAGCATGAACTCGAGTTCATGCTAGCATACACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025289.1-863s1c1
Sequence:CCGGCCTGTTATGAAGAACTGCTCACTCGAGTGAGCAGTTCTTCATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025289
VALIDATED
TBRG1 MISSION shRNA Lentiviral Transduction Particles
transforming growth factor beta regulator 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025289.3-950s21c1
Sequence:CCGGCCTGTTATGAAGAACTGCTCACTCGAGTGAGCAGTTCTTCATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025289.3-1161s21c1
Sequence:CCGGGCCAGAGAATGATGCAACTATCTCGAGATAGTTGCATCATTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025289.3-539s21c1
Sequence:CCGGAGGAACCATTTGCGAAGAAATCTCGAGATTTCTTCGCAAATGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025289.3-1409s21c1
Sequence:CCGGCCCTGCCTTCTCCTCATTATGCTCGAGCATAATGAGGAGAAGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025289.3-1098s21c1
Sequence:CCGGCAATTACCAGTGGGTGAAATTCTCGAGAATTTCACCCACTGGTAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025289.1-1074s1c1
Sequence:CCGGGCCAGAGAATGATGCAACTATCTCGAGATAGTTGCATCATTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025289.1-291s1c1
Sequence:CCGGAGAAAGAAGATACTTGCTGAACTCGAGTTCAGCAAGTATCTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025289.1-748s1c1
Sequence:CCGGCCAGACCAGAAGTGTCTGTATCTCGAGATACAGACACTTCTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025289.1-723s1c1
Sequence:CCGGCCGAGTGTATGCTAGCATGAACTCGAGTTCATGCTAGCATACACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025289.1-863s1c1
Sequence:CCGGCCTGTTATGAAGAACTGCTCACTCGAGTGAGCAGTTCTTCATAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks