EMAIL THIS PAGE TO A FRIEND

TBRG4

transforming growth factor beta regulator 4

Synonyms: CPR2 FASTKD4
Gene ID:
Mouse(21379) transforming growth factor beta regulated gene 4
Rat(360977) transforming growth factor beta regulator 4
cow(767855) transforming growth factor beta regulator 4
sheep(101113841) transforming growth factor beta regulator 4
domestic guinea pig(100717349) transforming growth factor beta regulator 4
naked mole-rat(101710872) transforming growth factor beta regulator 4
Zebrafish(562388) transforming growth factor beta regulator 4
domestic cat(101097220) transforming growth factor beta regulator 4
dog(482691) transforming growth factor beta regulator 4
chicken(420408) transforming growth factor beta regulator 4
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134011 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134011 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134011 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004749 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004749 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004749 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004749 Rosetta Predictions human pricing
NM_030900 Rosetta Predictions human pricing
NM_199122 Rosetta Predictions human pricing
NM_001012154 Rosetta Predictions rat pricing
XM_573656 Rosetta Predictions rat pricing
NM_001130457 Rosetta Predictions mouse pricing
NM_134011 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081315 predicted 463
2 SASI_Hs01_00081316 predicted 1730
3 SASI_Hs01_00081317 predicted 1899
4 SASI_Hs01_00081318 predicted 494
5 SASI_Hs01_00081319 predicted 407
6 SASI_Hs01_00081320 predicted 398
7 SASI_Hs01_00081322 predicted 294
8 SASI_Hs01_00081323 predicted 1448
9 SASI_Hs02_00338234 predicted 1756
10 SASI_Hs02_00338235 predicted 478
11 SASI_Hs01_00081314 predicted 1428
12 SASI_Hs01_00081321 predicted 1787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202168 predicted 470
2 SASI_Hs01_00202169 predicted 1403
3 SASI_Hs01_00202170 predicted 1570
4 SASI_Hs01_00202171 predicted 497
5 SASI_Hs01_00202172 predicted 415
6 SASI_Hs01_00202173 predicted 393
7 SASI_Hs01_00202175 predicted 298
8 SASI_Hs01_00202176 predicted 1116
9 SASI_Hs02_00358431 predicted 1432
10 SASI_Hs02_00358432 predicted 477
11 SASI_Hs01_00202167 predicted 1093
12 SASI_Hs01_00202174 predicted 1457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171524 predicted 449
2 SASI_Hs01_00171525 predicted 1387
3 SASI_Hs01_00171526 predicted 1548
4 SASI_Hs01_00171527 predicted 471
5 SASI_Hs01_00171528 predicted 394
6 SASI_Hs01_00171529 predicted 373
7 SASI_Hs01_00171531 predicted 273
8 SASI_Hs01_00171532 predicted 1091
9 SASI_Hs02_00372557 predicted 1407
10 SASI_Hs02_00372558 predicted 459
11 SASI_Hs01_00171523 predicted 1077
12 SASI_Hs01_00171530 predicted 1435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012154 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047543 predicted 1175
2 SASI_Rn01_00047544 predicted 1840
3 SASI_Rn01_00047545 predicted 437
4 SASI_Rn01_00047546 predicted 1074
5 SASI_Rn02_00200341 predicted 1378
6 SASI_Rn01_00047547 predicted 867
7 SASI_Rn01_00047549 predicted 435
8 SASI_Rn01_00047550 predicted 340
9 SASI_Rn01_00047551 predicted 804
10 SASI_Rn01_00047552 predicted 1849
11 SASI_Rn01_00047548 predicted 1102
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00188652 predicted 1306
2 SASI_Rn01_00188653 predicted 1969
3 SASI_Rn01_00188654 predicted 563
4 SASI_Rn01_00188655 predicted 1212
5 SASI_Rn01_00188656 predicted 1002
6 SASI_Rn01_00188657 predicted 1224
7 SASI_Rn01_00188658 predicted 566
8 SASI_Rn01_00188659 predicted 477
9 SASI_Rn01_00188660 predicted 938
10 SASI_Rn01_00188661 predicted 1980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130457 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311278 predicted 1135
2 SASI_Mm02_00311279 predicted 620
3 SASI_Mm02_00311280 predicted 1355
4 SASI_Mm02_00311281 predicted 883
5 SASI_Mm02_00311282 predicted 407
6 SASI_Mm02_00311283 predicted 605
7 SASI_Mm02_00311284 predicted 872
8 SASI_Mm02_00311285 predicted 616
9 SASI_Mm02_00311286 predicted 609
10 SASI_Mm02_00311287 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134011 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339158 predicted 1135
2 SASI_Mm01_00108280 predicted 617
3 SASI_Mm01_00108281 predicted 1351
4 SASI_Mm01_00108282 predicted 879
5 SASI_Mm01_00108283 predicted 406
6 SASI_Mm01_00108285 predicted 611
7 SASI_Mm01_00108287 predicted 864
8 SASI_Mm01_00108288 predicted 613
9 SASI_Mm01_00108289 predicted 605
10 SASI_Mm02_00339159 predicted 599
11 SASI_Mm01_00108284 predicted 1964
12 SASI_Mm01_00108286 predicted 1974
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134011
VALIDATED
TBRG4 MISSION shRNA Bacterial Glycerol Stock
transforming growth factor beta regulator 4
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134011.1-2151s1c1
Sequence:CCGGGCCAGAGTTGTCATCCAACATCTCGAGATGTTGGATGACAACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134011.1-1982s1c1
Sequence:CCGGCCATATTATGAATGGCTGGATCTCGAGATCCAGCCATTCATAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134011.1-1967s1c1
Sequence:CCGGCTGGTAGTAGATGTCCCATATCTCGAGATATGGGACATCTACTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134011.1-1966s1c1
Sequence:CCGGCCTGGTAGTAGATGTCCCATACTCGAGTATGGGACATCTACTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134011.1-563s1c1
Sequence:CCGGCAGCGACTTGTCAAGCTAGTTCTCGAGAACTAGCTTGACAAGTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134011.2-2342s21c1
Sequence:CCGGTATCTCCTCTCTCTCGTATTTCTCGAGAAATACGAGAGAGAGGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134011.2-500s21c1
Sequence:CCGGACCATAGCCTGCACCACAATCCTCGAGGATTGTGGTGCAGGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134011.2-877s21c1
Sequence:CCGGATCAACGACAGCCGTACATTGCTCGAGCAATGTACGGCTGTCGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134011.2-2010s21c1
Sequence:CCGGCCTGGTAGTAGATGTCCCATACTCGAGTATGGGACATCTACTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134011.2-607s21c1
Sequence:CCGGCAGCGACTTGTCAAGCTAGTTCTCGAGAACTAGCTTGACAAGTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134011.2-2276s21c1
Sequence:CCGGGGAACGGGTGGTCCTAATAAACTCGAGTTTATTAGGACCACCCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134011.2-1613s21c1
Sequence:CCGGTGCTGGAGCACCCTGAATATACTCGAGTATATTCAGGGTGCTCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134011
VALIDATED
TBRG4 MISSION shRNA shRNA Plasmid DNA
transforming growth factor beta regulator 4
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134011.1-2151s1c1
Sequence:CCGGGCCAGAGTTGTCATCCAACATCTCGAGATGTTGGATGACAACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134011.1-1982s1c1
Sequence:CCGGCCATATTATGAATGGCTGGATCTCGAGATCCAGCCATTCATAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134011.1-1967s1c1
Sequence:CCGGCTGGTAGTAGATGTCCCATATCTCGAGATATGGGACATCTACTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134011.1-1966s1c1
Sequence:CCGGCCTGGTAGTAGATGTCCCATACTCGAGTATGGGACATCTACTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134011.1-563s1c1
Sequence:CCGGCAGCGACTTGTCAAGCTAGTTCTCGAGAACTAGCTTGACAAGTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134011.2-2342s21c1
Sequence:CCGGTATCTCCTCTCTCTCGTATTTCTCGAGAAATACGAGAGAGAGGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134011.2-500s21c1
Sequence:CCGGACCATAGCCTGCACCACAATCCTCGAGGATTGTGGTGCAGGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134011.2-877s21c1
Sequence:CCGGATCAACGACAGCCGTACATTGCTCGAGCAATGTACGGCTGTCGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134011.2-2010s21c1
Sequence:CCGGCCTGGTAGTAGATGTCCCATACTCGAGTATGGGACATCTACTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134011.2-607s21c1
Sequence:CCGGCAGCGACTTGTCAAGCTAGTTCTCGAGAACTAGCTTGACAAGTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134011.2-2276s21c1
Sequence:CCGGGGAACGGGTGGTCCTAATAAACTCGAGTTTATTAGGACCACCCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134011.2-1613s21c1
Sequence:CCGGTGCTGGAGCACCCTGAATATACTCGAGTATATTCAGGGTGCTCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134011
VALIDATED
TBRG4 MISSION shRNA Lentiviral Transduction Particles
transforming growth factor beta regulator 4
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134011.1-2151s1c1
Sequence:CCGGGCCAGAGTTGTCATCCAACATCTCGAGATGTTGGATGACAACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134011.1-1982s1c1
Sequence:CCGGCCATATTATGAATGGCTGGATCTCGAGATCCAGCCATTCATAATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134011.1-1967s1c1
Sequence:CCGGCTGGTAGTAGATGTCCCATATCTCGAGATATGGGACATCTACTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134011.1-1966s1c1
Sequence:CCGGCCTGGTAGTAGATGTCCCATACTCGAGTATGGGACATCTACTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134011.1-563s1c1
Sequence:CCGGCAGCGACTTGTCAAGCTAGTTCTCGAGAACTAGCTTGACAAGTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134011.2-2342s21c1
Sequence:CCGGTATCTCCTCTCTCTCGTATTTCTCGAGAAATACGAGAGAGAGGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134011.2-500s21c1
Sequence:CCGGACCATAGCCTGCACCACAATCCTCGAGGATTGTGGTGCAGGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134011.2-877s21c1
Sequence:CCGGATCAACGACAGCCGTACATTGCTCGAGCAATGTACGGCTGTCGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134011.2-2010s21c1
Sequence:CCGGCCTGGTAGTAGATGTCCCATACTCGAGTATGGGACATCTACTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134011.2-607s21c1
Sequence:CCGGCAGCGACTTGTCAAGCTAGTTCTCGAGAACTAGCTTGACAAGTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134011.2-2276s21c1
Sequence:CCGGGGAACGGGTGGTCCTAATAAACTCGAGTTTATTAGGACCACCCGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134011.2-1613s21c1
Sequence:CCGGTGCTGGAGCACCCTGAATATACTCGAGTATATTCAGGGTGCTCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004749
VALIDATED
TBRG4 MISSION shRNA Bacterial Glycerol Stock
transforming growth factor beta regulator 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_004749.2-310s1c1
Sequence:CCGGCGAGCATCTACTCCCTACATACTCGAGTATGTAGGGAGTAGATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004749.2-651s1c1
Sequence:CCGGCATGCGGAAGCTCAAGTACAACTCGAGTTGTACTTGAGCTTCCGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004749.2-1288s1c1
Sequence:CCGGCAGTTCTTCAGCCTGGTACATCTCGAGATGTACCAGGCTGAAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004749.2-496s1c1
Sequence:CCGGGATGCCCACTTTCATCAACTTCTCGAGAAGTTGATGAAAGTGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004749.2-465s1c1
Sequence:CCGGGAAGCCAGAAGATAAAGGCTTCTCGAGAAGCCTTTATCTTCTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004749.2-766s1c1
Sequence:CCGGCGTTGGACAGAAATTGAAGATCTCGAGATCTTCAATTTCTGTCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004749.2-792s1c1
Sequence:CCGGCACATTAGTGACCGTCATGATCTCGAGATCATGACGGTCACTAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004749.2-1423s21c1
Sequence:CCGGCCTGAATTTCACATCCAATTTCTCGAGAAATTGGATGTGAAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232666    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004749.2-2086s21c1
Sequence:CCGGGGGTCACCCTTGAGGACAAACCTCGAGGTTTGTCCTCAAGGGTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004749.2-420s21c1
Sequence:CCGGTCAAGCAGCAATGGTACTTATCTCGAGATAAGTACCATTGCTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004749.2-311s21c1
Sequence:CCGGGAGCATCTACTCCCTACATAGCTCGAGCTATGTAGGGAGTAGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004749.2-216s21c1
Sequence:CCGGACTTGCCTGGGTAGCCCATAACTCGAGTTATGGGCTACCCAGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004749
VALIDATED
TBRG4 MISSION shRNA shRNA Plasmid DNA
transforming growth factor beta regulator 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_004749.2-310s1c1
Sequence:CCGGCGAGCATCTACTCCCTACATACTCGAGTATGTAGGGAGTAGATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004749.2-651s1c1
Sequence:CCGGCATGCGGAAGCTCAAGTACAACTCGAGTTGTACTTGAGCTTCCGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004749.2-1288s1c1
Sequence:CCGGCAGTTCTTCAGCCTGGTACATCTCGAGATGTACCAGGCTGAAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004749.2-496s1c1
Sequence:CCGGGATGCCCACTTTCATCAACTTCTCGAGAAGTTGATGAAAGTGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004749.2-465s1c1
Sequence:CCGGGAAGCCAGAAGATAAAGGCTTCTCGAGAAGCCTTTATCTTCTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004749.2-766s1c1
Sequence:CCGGCGTTGGACAGAAATTGAAGATCTCGAGATCTTCAATTTCTGTCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004749.2-792s1c1
Sequence:CCGGCACATTAGTGACCGTCATGATCTCGAGATCATGACGGTCACTAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004749.2-1423s21c1
Sequence:CCGGCCTGAATTTCACATCCAATTTCTCGAGAAATTGGATGTGAAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232666    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004749.2-2086s21c1
Sequence:CCGGGGGTCACCCTTGAGGACAAACCTCGAGGTTTGTCCTCAAGGGTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004749.2-420s21c1
Sequence:CCGGTCAAGCAGCAATGGTACTTATCTCGAGATAAGTACCATTGCTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004749.2-311s21c1
Sequence:CCGGGAGCATCTACTCCCTACATAGCTCGAGCTATGTAGGGAGTAGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004749.2-216s21c1
Sequence:CCGGACTTGCCTGGGTAGCCCATAACTCGAGTTATGGGCTACCCAGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004749
VALIDATED
TBRG4 MISSION shRNA Lentiviral Transduction Particles
transforming growth factor beta regulator 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_004749.2-310s1c1
Sequence:CCGGCGAGCATCTACTCCCTACATACTCGAGTATGTAGGGAGTAGATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004749.2-651s1c1
Sequence:CCGGCATGCGGAAGCTCAAGTACAACTCGAGTTGTACTTGAGCTTCCGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004749.2-1288s1c1
Sequence:CCGGCAGTTCTTCAGCCTGGTACATCTCGAGATGTACCAGGCTGAAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004749.2-496s1c1
Sequence:CCGGGATGCCCACTTTCATCAACTTCTCGAGAAGTTGATGAAAGTGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004749.2-465s1c1
Sequence:CCGGGAAGCCAGAAGATAAAGGCTTCTCGAGAAGCCTTTATCTTCTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004749.2-766s1c1
Sequence:CCGGCGTTGGACAGAAATTGAAGATCTCGAGATCTTCAATTTCTGTCCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004749.2-792s1c1
Sequence:CCGGCACATTAGTGACCGTCATGATCTCGAGATCATGACGGTCACTAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004749.2-1423s21c1
Sequence:CCGGCCTGAATTTCACATCCAATTTCTCGAGAAATTGGATGTGAAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232666    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004749.2-2086s21c1
Sequence:CCGGGGGTCACCCTTGAGGACAAACCTCGAGGTTTGTCCTCAAGGGTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004749.2-420s21c1
Sequence:CCGGTCAAGCAGCAATGGTACTTATCTCGAGATAAGTACCATTGCTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004749.2-311s21c1
Sequence:CCGGGAGCATCTACTCCCTACATAGCTCGAGCTATGTAGGGAGTAGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004749.2-216s21c1
Sequence:CCGGACTTGCCTGGGTAGCCCATAACTCGAGTTATGGGCTACCCAGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks