EMAIL THIS PAGE TO A FRIEND

TBX10

T-box 10

Synonyms: TBX13 TBX7
UniProtKB ID: O75333, Q14D64, Q86XS3
Gene ID:
Human(347853) Summary: This gene encodes a member of the T-box family of transcription factors. These transcription factors share a DNA-binding domain called the T-box, and play a role in several developmental processes including early embryonic cell fate and organogenesis. The encoded protein is a member of the T-box 1 subfamily. Mutations in this gene are thought to be a cause of isolated cleft lip with or without cleft palate. [provided by RefSeq, Nov 2010]
Mouse(109575) T-box 10
Rat(688822) T-box 10
cow(618314) T-box 10
sheep(101111676) T-box 10
chicken(428814) T-box 10
dog(611811) T-box 10
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001320 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001320 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001320 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005995 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005995 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005995 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139851 MISSION® esiRNA esiRNA human TBX10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005995 Rosetta Predictions human pricing
XM_001068444 Rosetta Predictions rat pricing
NM_001001320 Rosetta Predictions mouse pricing
NM_011533 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005995 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221452 predicted 757
2 SASI_Hs01_00221457 predicted 275
3 SASI_Hs01_00221458 predicted 301
4 SASI_Hs01_00221459 predicted 1048
5 SASI_Hs01_00221460 predicted 671
6 SASI_Hs01_00221461 predicted 823
7 SASI_Hs02_00340697 predicted 707
8 SASI_Hs02_00340698 predicted 303
9 SASI_Hs02_00340699 predicted 770
10 SASI_Hs02_00340700 predicted 760
11 SASI_Hs01_00221453 predicted 290
12 SASI_Hs01_00221454 predicted 1290
13 SASI_Hs01_00221455 predicted 638
14 SASI_Hs01_00221456 predicted 1273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068444 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324557 predicted 790
2 SASI_Rn02_00324558 predicted 836
3 SASI_Rn02_00324559 predicted 706
4 SASI_Rn02_00324560 predicted 921
5 SASI_Rn02_00324561 predicted 625
6 SASI_Rn02_00324562 predicted 867
7 SASI_Rn02_00324563 predicted 1265
8 SASI_Rn02_00324564 predicted 1027
9 SASI_Rn02_00324565 predicted 928
10 SASI_Rn02_00324566 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001320 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158715 predicted 1475
2 SASI_Mm02_00286120 predicted 1209
3 SASI_Mm02_00286121 predicted 841
4 SASI_Mm01_00158718 predicted 705
5 SASI_Mm02_00286122 predicted 876
6 SASI_Mm01_00158719 predicted 904
7 SASI_Mm01_00158720 predicted 624
8 SASI_Mm01_00158721 predicted 677
9 SASI_Mm02_00286123 predicted 1554
10 SASI_Mm01_00158724 predicted 687
11 SASI_Mm01_00158716 predicted 1063
12 SASI_Mm01_00158717 predicted 603
13 SASI_Mm01_00158722 predicted 544
14 SASI_Mm01_00158723 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011533 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320853 predicted 1313
2 SASI_Mm02_00320854 predicted 1051
3 SASI_Mm02_00320855 predicted 681
4 SASI_Mm02_00320856 predicted 546
5 SASI_Mm02_00320857 predicted 717
6 SASI_Mm02_00320858 predicted 756
7 SASI_Mm02_00320859 predicted 468
8 SASI_Mm02_00320860 predicted 516
9 SASI_Mm02_00320861 predicted 1395
10 SASI_Mm02_00320862 predicted 529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001320
TBX10 MISSION shRNA Bacterial Glycerol Stock
T-box 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001320.1-845s1c1
Sequence:CCGGGCAGATTGTGTCCTTTGACAACTCGAGTTGTCAAAGGACACAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001320.1-689s1c1
Sequence:CCGGCGCTTTGCTCATGGACTTTATCTCGAGATAAAGTCCATGAGCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001320.1-1215s1c1
Sequence:CCGGCGAGAGAAAGATACCAGTAAACTCGAGTTTACTGGTATCTTTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001320.1-710s1c1
Sequence:CCGGCCCGTTGGATGACAAGAGATACTCGAGTATCTCTTGTCATCCAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001320.1-1567s1c1
Sequence:CCGGCCTCTGTAAGACATCTCCTAACTCGAGTTAGGAGATGTCTTACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001320
TBX10 MISSION shRNA shRNA Plasmid DNA
T-box 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001320.1-845s1c1
Sequence:CCGGGCAGATTGTGTCCTTTGACAACTCGAGTTGTCAAAGGACACAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001320.1-689s1c1
Sequence:CCGGCGCTTTGCTCATGGACTTTATCTCGAGATAAAGTCCATGAGCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001320.1-1215s1c1
Sequence:CCGGCGAGAGAAAGATACCAGTAAACTCGAGTTTACTGGTATCTTTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001320.1-710s1c1
Sequence:CCGGCCCGTTGGATGACAAGAGATACTCGAGTATCTCTTGTCATCCAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001320.1-1567s1c1
Sequence:CCGGCCTCTGTAAGACATCTCCTAACTCGAGTTAGGAGATGTCTTACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001320
TBX10 MISSION shRNA Lentiviral Transduction Particles
T-box 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001320.1-845s1c1
Sequence:CCGGGCAGATTGTGTCCTTTGACAACTCGAGTTGTCAAAGGACACAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001320.1-689s1c1
Sequence:CCGGCGCTTTGCTCATGGACTTTATCTCGAGATAAAGTCCATGAGCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001320.1-1215s1c1
Sequence:CCGGCGAGAGAAAGATACCAGTAAACTCGAGTTTACTGGTATCTTTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001320.1-710s1c1
Sequence:CCGGCCCGTTGGATGACAAGAGATACTCGAGTATCTCTTGTCATCCAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001320.1-1567s1c1
Sequence:CCGGCCTCTGTAAGACATCTCCTAACTCGAGTTAGGAGATGTCTTACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005995
TBX10 MISSION shRNA Bacterial Glycerol Stock
T-box 10
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005995.2-728s1c1
Sequence:CCGGGAACTTCAAGTCCTTCATCTTCTCGAGAAGATGAAGGACTTGAAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005995.2-644s1c1
Sequence:CCGGTCTCAACTCTATGCACCGCTACTCGAGTAGCGGTGCATAGAGTTGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005995.2-1149s1c1
Sequence:CCGGCGGGCTGATAGGGATCAAGGACTCGAGTCCTTGATCCCTATCAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005995.2-564s1c1
Sequence:CCGGGCCCAGTGGATGCGCCAGATTCTCGAGAATCTGGCGCATCCACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005995.2-383s1c1
Sequence:CCGGCCAGGTGAAGATCCTGGGCATCTCGAGATGCCCAGGATCTTCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005995.3-612s21c1
Sequence:CCGGACAACCTGCTGGATGACAATGCTCGAGCATTGTCATCCAGCAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005995.3-1357s21c1
Sequence:CCGGTAGGTGAAAGTCTAGAGAAAGCTCGAGCTTTCTCTAGACTTTCACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005995
TBX10 MISSION shRNA shRNA Plasmid DNA
T-box 10
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005995.2-728s1c1
Sequence:CCGGGAACTTCAAGTCCTTCATCTTCTCGAGAAGATGAAGGACTTGAAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005995.2-644s1c1
Sequence:CCGGTCTCAACTCTATGCACCGCTACTCGAGTAGCGGTGCATAGAGTTGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005995.2-1149s1c1
Sequence:CCGGCGGGCTGATAGGGATCAAGGACTCGAGTCCTTGATCCCTATCAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005995.2-564s1c1
Sequence:CCGGGCCCAGTGGATGCGCCAGATTCTCGAGAATCTGGCGCATCCACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005995.2-383s1c1
Sequence:CCGGCCAGGTGAAGATCCTGGGCATCTCGAGATGCCCAGGATCTTCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005995.3-612s21c1
Sequence:CCGGACAACCTGCTGGATGACAATGCTCGAGCATTGTCATCCAGCAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005995.3-1357s21c1
Sequence:CCGGTAGGTGAAAGTCTAGAGAAAGCTCGAGCTTTCTCTAGACTTTCACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005995
TBX10 MISSION shRNA Lentiviral Transduction Particles
T-box 10
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005995.2-728s1c1
Sequence:CCGGGAACTTCAAGTCCTTCATCTTCTCGAGAAGATGAAGGACTTGAAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005995.2-644s1c1
Sequence:CCGGTCTCAACTCTATGCACCGCTACTCGAGTAGCGGTGCATAGAGTTGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005995.2-1149s1c1
Sequence:CCGGCGGGCTGATAGGGATCAAGGACTCGAGTCCTTGATCCCTATCAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005995.2-564s1c1
Sequence:CCGGGCCCAGTGGATGCGCCAGATTCTCGAGAATCTGGCGCATCCACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005995.2-383s1c1
Sequence:CCGGCCAGGTGAAGATCCTGGGCATCTCGAGATGCCCAGGATCTTCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005995.3-612s21c1
Sequence:CCGGACAACCTGCTGGATGACAATGCTCGAGCATTGTCATCCAGCAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005995.3-1357s21c1
Sequence:CCGGTAGGTGAAAGTCTAGAGAAAGCTCGAGCTTTCTCTAGACTTTCACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks