EMAIL THIS PAGE TO A FRIEND

TBX15

T-box 15

Synonyms: TBX14
UniProtKB ID: Q96SF7, Q08E76, Q5JT54, Q5T9S7
Gene ID:
Human(6913) Summary: This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
Mouse(21384) T-box 15
Rat(295315) T-box 15
chicken(418313) T-box 15
Horse(100066709) T-box 15
dog(483144) T-box 15
cow(521974) T-box 15
sheep(101110282) T-box 15
174 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV47723 Anti-TBX15 antibody produced in rabbit IgG fraction of antiserum mouse, rat, human, rabbit, canine, horse, guinea pig
immunohistochemistry, western blot pricing
SAB2102380 Anti-TBX15 antibody produced in rabbit affinity isolated antibody human, rat, guinea pig, zebrafish, rabbit, canine, mouse, horse
western blot pricing
HPA052245 Anti-TBX15 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009323 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009323 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009323 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_371284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371284 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011534 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011534 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011534 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152380 Rosetta Predictions human pricing
NM_001106451 Rosetta Predictions rat pricing
NM_009323 Rosetta Predictions mouse pricing
NM_011534 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022192 predicted 824
2 SASI_Hs01_00022193 predicted 411
3 SASI_Hs02_00366033 predicted 373
4 SASI_Hs01_00022194 predicted 1152
5 SASI_Hs01_00022197 predicted 1534
6 SASI_Hs01_00022198 predicted 658
7 SASI_Hs01_00022199 predicted 710
8 SASI_Hs01_00022200 predicted 1149
9 SASI_Hs01_00022201 predicted 800
10 SASI_Hs02_00366034 predicted 922
11 SASI_Hs01_00022195 predicted 1619
12 SASI_Hs01_00022196 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106451 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219088 predicted 382
2 SASI_Rn02_00219089 predicted 519
3 SASI_Rn02_00219090 predicted 406
4 SASI_Rn02_00219091 predicted 988
5 SASI_Rn02_00219092 predicted 278
6 SASI_Rn02_00219093 predicted 373
7 SASI_Rn02_00219094 predicted 456
8 SASI_Rn02_00219095 predicted 533
9 SASI_Rn02_00219096 predicted 256
10 SASI_Rn02_00219097 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009323 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113327 predicted 791
2 SASI_Mm02_00315868 predicted 1207
3 SASI_Mm02_00315869 predicted 1048
4 SASI_Mm02_00315870 predicted 451
5 SASI_Mm02_00315871 predicted 1067
6 SASI_Mm01_00113330 predicted 710
7 SASI_Mm02_00315872 predicted 864
8 SASI_Mm02_00315873 predicted 1634
9 SASI_Mm02_00315874 predicted 1710
10 SASI_Mm02_00315875 predicted 1218
11 SASI_Mm01_00113325 predicted 636
12 SASI_Mm01_00113326 predicted 617
13 SASI_Mm01_00113328 predicted 698
14 SASI_Mm01_00113329 predicted 602
15 SASI_Mm01_00113331 predicted 590
16 SASI_Mm01_00113332 predicted 728
17 SASI_Mm01_00113333 predicted 560
18 SASI_Mm01_00113334 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011534 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114792 predicted 962
2 SASI_Mm01_00114793 predicted 945
3 SASI_Mm01_00114794 predicted 1028
4 SASI_Mm01_00114795 predicted 1018
5 SASI_Mm01_00114796 predicted 925
6 SASI_Mm01_00114797 predicted 940
7 SASI_Mm01_00114798 predicted 915
8 SASI_Mm01_00114799 predicted 1042
9 SASI_Mm01_00114800 predicted 891
10 SASI_Mm01_00114801 predicted 1032
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009323
TBX15 MISSION shRNA Bacterial Glycerol Stock
T-box 15
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000334005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009323.2-584s21c1
Sequence:CCGGCCACATCAGCAATACTATATACTCGAGTATATAGTATTGCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009323.2-1729s21c1
Sequence:CCGGCGCGTCTCAAAGCACTTTACTCTCGAGAGTAAAGTGCTTTGAGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009323.2-863s21c1
Sequence:CCGGCGCAAAGACTTTAGCAGTGATCTCGAGATCACTGCTAAAGTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009323.2-1296s21c1
Sequence:CCGGGTAATCTAAACCTCTCTGATTCTCGAGAATCAGAGAGGTTTAGATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009323
TBX15 MISSION shRNA shRNA Plasmid DNA
T-box 15
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000334005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009323.2-584s21c1
Sequence:CCGGCCACATCAGCAATACTATATACTCGAGTATATAGTATTGCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009323.2-1729s21c1
Sequence:CCGGCGCGTCTCAAAGCACTTTACTCTCGAGAGTAAAGTGCTTTGAGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009323.2-863s21c1
Sequence:CCGGCGCAAAGACTTTAGCAGTGATCTCGAGATCACTGCTAAAGTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009323.2-1296s21c1
Sequence:CCGGGTAATCTAAACCTCTCTGATTCTCGAGAATCAGAGAGGTTTAGATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009323
TBX15 MISSION shRNA Lentiviral Transduction Particles
T-box 15
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000334005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009323.2-584s21c1
Sequence:CCGGCCACATCAGCAATACTATATACTCGAGTATATAGTATTGCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009323.2-1729s21c1
Sequence:CCGGCGCGTCTCAAAGCACTTTACTCTCGAGAGTAAAGTGCTTTGAGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009323.2-863s21c1
Sequence:CCGGCGCAAAGACTTTAGCAGTGATCTCGAGATCACTGCTAAAGTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009323.2-1296s21c1
Sequence:CCGGGTAATCTAAACCTCTCTGATTCTCGAGAATCAGAGAGGTTTAGATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371284
TBX15 MISSION shRNA Bacterial Glycerol Stock
T-box 15
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371284.2-724s1c1
Sequence:CCGGCGAGTTCATGTGATTCGCAAACTCGAGTTTGCGAATCACATGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371284.2-842s1c1
Sequence:CCGGCCTATCAGAATCAGCAGATTACTCGAGTAATCTGCTGATTCTGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371284.2-1630s1c1
Sequence:CCGGCACAACCCTTACAACCTGTATCTCGAGATACAGGTTGTAAGGGTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371284.2-375s1c1
Sequence:CCGGCCATGATATTGGAACTGAAATCTCGAGATTTCAGTTCCAATATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371284.2-1426s1c1
Sequence:CCGGCCATCCCTGATCTCAGGAATACTCGAGTATTCCTGAGATCAGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371284
TBX15 MISSION shRNA shRNA Plasmid DNA
T-box 15
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371284.2-724s1c1
Sequence:CCGGCGAGTTCATGTGATTCGCAAACTCGAGTTTGCGAATCACATGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371284.2-842s1c1
Sequence:CCGGCCTATCAGAATCAGCAGATTACTCGAGTAATCTGCTGATTCTGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371284.2-1630s1c1
Sequence:CCGGCACAACCCTTACAACCTGTATCTCGAGATACAGGTTGTAAGGGTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371284.2-375s1c1
Sequence:CCGGCCATGATATTGGAACTGAAATCTCGAGATTTCAGTTCCAATATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371284.2-1426s1c1
Sequence:CCGGCCATCCCTGATCTCAGGAATACTCGAGTATTCCTGAGATCAGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371284
TBX15 MISSION shRNA Lentiviral Transduction Particles
T-box 15
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371284.2-724s1c1
Sequence:CCGGCGAGTTCATGTGATTCGCAAACTCGAGTTTGCGAATCACATGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371284.2-842s1c1
Sequence:CCGGCCTATCAGAATCAGCAGATTACTCGAGTAATCTGCTGATTCTGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371284.2-1630s1c1
Sequence:CCGGCACAACCCTTACAACCTGTATCTCGAGATACAGGTTGTAAGGGTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371284.2-375s1c1
Sequence:CCGGCCATGATATTGGAACTGAAATCTCGAGATTTCAGTTCCAATATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371284.2-1426s1c1
Sequence:CCGGCCATCCCTGATCTCAGGAATACTCGAGTATTCCTGAGATCAGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011534
VALIDATED
TBX15 MISSION shRNA Bacterial Glycerol Stock
T-box 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011534.1-2311s1c1
Sequence:CCGGACAACAATAGATACCGCTGAACTCGAGTTCAGCGGTATCTATTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011534.1-1086s1c1
Sequence:CCGGCGCAAAGACTTTAGCAGTGATCTCGAGATCACTGCTAAAGTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011534.1-1519s1c1
Sequence:CCGGGTAATCTAAACCTCTCTGATTCTCGAGAATCAGAGAGGTTTAGATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011534.1-807s1c1
Sequence:CCGGCCACATCAGCAATACTATATACTCGAGTATATAGTATTGCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011534.1-1952s1c1
Sequence:CCGGCGCGTCTCAAAGCACTTTACTCTCGAGAGTAAAGTGCTTTGAGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011534
VALIDATED
TBX15 MISSION shRNA shRNA Plasmid DNA
T-box 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011534.1-2311s1c1
Sequence:CCGGACAACAATAGATACCGCTGAACTCGAGTTCAGCGGTATCTATTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011534.1-1086s1c1
Sequence:CCGGCGCAAAGACTTTAGCAGTGATCTCGAGATCACTGCTAAAGTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011534.1-1519s1c1
Sequence:CCGGGTAATCTAAACCTCTCTGATTCTCGAGAATCAGAGAGGTTTAGATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011534.1-807s1c1
Sequence:CCGGCCACATCAGCAATACTATATACTCGAGTATATAGTATTGCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011534.1-1952s1c1
Sequence:CCGGCGCGTCTCAAAGCACTTTACTCTCGAGAGTAAAGTGCTTTGAGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011534
VALIDATED
TBX15 MISSION shRNA Lentiviral Transduction Particles
T-box 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011534.1-2311s1c1
Sequence:CCGGACAACAATAGATACCGCTGAACTCGAGTTCAGCGGTATCTATTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011534.1-1086s1c1
Sequence:CCGGCGCAAAGACTTTAGCAGTGATCTCGAGATCACTGCTAAAGTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011534.1-1519s1c1
Sequence:CCGGGTAATCTAAACCTCTCTGATTCTCGAGAATCAGAGAGGTTTAGATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011534.1-807s1c1
Sequence:CCGGCCACATCAGCAATACTATATACTCGAGTATATAGTATTGCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011534.1-1952s1c1
Sequence:CCGGCGCGTCTCAAAGCACTTTACTCTCGAGAGTAAAGTGCTTTGAGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks