EMAIL THIS PAGE TO A FRIEND

TBX18

T-box 18

UniProtKB ID: O95935, A2RU13, Q7Z6U4, Q9UJI6
Gene ID:
Human(9096) Summary: This genes codes for a member of an evolutionarily conserved family of transcription factors that plays a crucial role in embryonic development. The family is characterized by the presence of the DNA-binding T-box domain and is divided into five sub-families based on sequence conservation in this domain. The encoded protein belongs to the vertebrate specific Tbx1 sub-family. The protein acts as a transcriptional repressor by antagonizing transcriptional activators in the T-box family. The protein forms homo- or heterodimers with other transcription factors of the T-box family or other transcription factors. [provided by RefSeq, Nov 2012]
Mouse(76365) T-box18
Rat(315870) T-box18
chicken(395104) T-box 18
Horse(100065507) T-box 18
dog(481903) T-box 18
cow(517044) T-box 18
sheep(101117084) T-box 18
167 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503550 Anti-TBX15 antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB2102381 Anti-TBX18 (ab1) antibody produced in rabbit affinity isolated antibody rabbit, canine, mouse, rat, horse, bovine, human, guinea pig
western blot pricing
SAB2102382 Anti-TBX18 (ab2) antibody produced in rabbit affinity isolated antibody zebrafish, guinea pig, horse, bovine, human, rat, mouse, rabbit, canine
western blot pricing
SAB1412361 ANTI-TBX18 antibody produced in mouse clone 1A1, purified immunoglobulin, buffered aqueous solution , human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412362 ANTI-TBX18 antibody produced in mouse clone 4D3, purified immunoglobulin, buffered aqueous solution , human,
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA029014 Anti-TBX18 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2105422 Anti-TBX18 antibody produced in rabbit affinity isolated antibody mouse, rabbit, guinea pig, horse
western blot pricing
WH0009096M1 Monoclonal Anti-TBX18 antibody produced in mouse clone 3D9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404670 Monoclonal Anti-TBX18 antibody produced in mouse clone 3C12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023814 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023814 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023814 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080508 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080508 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080508 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089941 MISSION® esiRNA esiRNA human TBX18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080508 Rosetta Predictions human pricing
XM_496819 Rosetta Predictions human pricing
NM_001108173 Rosetta Predictions rat pricing
NM_023814 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315517 predicted 871
2 SASI_Hs02_00315518 predicted 1305
3 SASI_Hs02_00315519 predicted 707
4 SASI_Hs02_00315520 predicted 513
5 SASI_Hs02_00315521 predicted 509
6 SASI_Hs02_00315522 predicted 1580
7 SASI_Hs02_00315523 predicted 1608
8 SASI_Hs02_00315524 predicted 865
9 SASI_Hs02_00315525 predicted 950
10 SASI_Hs02_00315526 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279152 predicted 870
2 SASI_Hs01_00279153 predicted 766
3 SASI_Hs01_00279154 predicted 1305
4 SASI_Hs01_00279155 predicted 717
5 SASI_Hs01_00279156 predicted 521
6 SASI_Hs01_00279157 predicted 522
7 SASI_Hs01_00279158 predicted 1587
8 SASI_Hs01_00279159 predicted 1616
9 SASI_Hs01_00279160 predicted 955
10 SASI_Hs01_00279161 predicted 1088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108173 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236064 predicted 948
2 SASI_Rn02_00236065 predicted 1144
3 SASI_Rn02_00236066 predicted 874
4 SASI_Rn02_00236067 predicted 1201
5 SASI_Rn02_00236068 predicted 1742
6 SASI_Rn02_00236069 predicted 2015
7 SASI_Rn02_00236070 predicted 2037
8 SASI_Rn02_00236071 predicted 1529
9 SASI_Rn02_00236072 predicted 2019
10 SASI_Rn02_00236073 predicted 1382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327370 predicted 1499
2 SASI_Mm01_00183330 predicted 1092
3 SASI_Mm01_00183331 predicted 528
4 SASI_Mm01_00183332 predicted 2013
5 SASI_Mm01_00183333 predicted 1093
6 SASI_Mm01_00183334 predicted 1199
7 SASI_Mm01_00183335 predicted 2207
8 SASI_Mm01_00183336 predicted 1373
9 SASI_Mm01_00183337 predicted 1315
10 SASI_Mm01_00183338 predicted 1247
11 SASI_Mm01_00183339 predicted 2049
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023814
TBX18 MISSION shRNA Bacterial Glycerol Stock
T-box 18
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023814.2-2993s1c1
Sequence:CCGGGCCCAGCCATTCCTGTTTATTCTCGAGAATAAACAGGAATGGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023814.2-1241s1c1
Sequence:CCGGCGTGTGCATGTCATCCGTAAACTCGAGTTTACGGATGACATGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023814.2-1382s1c1
Sequence:CCGGCGCCTTAAGATAGACAGGAATCTCGAGATTCCTGTCTATCTTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023814.2-1255s1c1
Sequence:CCGGCCGTAAAGATTGCGGAGATGACTCGAGTCATCTCCGCAATCTTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023814.2-1978s1c1
Sequence:CCGGCCAGAGTTCTTACAACACCTTCTCGAGAAGGTGTTGTAAGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023814
TBX18 MISSION shRNA shRNA Plasmid DNA
T-box 18
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023814.2-2993s1c1
Sequence:CCGGGCCCAGCCATTCCTGTTTATTCTCGAGAATAAACAGGAATGGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023814.2-1241s1c1
Sequence:CCGGCGTGTGCATGTCATCCGTAAACTCGAGTTTACGGATGACATGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023814.2-1382s1c1
Sequence:CCGGCGCCTTAAGATAGACAGGAATCTCGAGATTCCTGTCTATCTTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023814.2-1255s1c1
Sequence:CCGGCCGTAAAGATTGCGGAGATGACTCGAGTCATCTCCGCAATCTTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023814.2-1978s1c1
Sequence:CCGGCCAGAGTTCTTACAACACCTTCTCGAGAAGGTGTTGTAAGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023814
TBX18 MISSION shRNA Lentiviral Transduction Particles
T-box 18
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023814.2-2993s1c1
Sequence:CCGGGCCCAGCCATTCCTGTTTATTCTCGAGAATAAACAGGAATGGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023814.2-1241s1c1
Sequence:CCGGCGTGTGCATGTCATCCGTAAACTCGAGTTTACGGATGACATGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023814.2-1382s1c1
Sequence:CCGGCGCCTTAAGATAGACAGGAATCTCGAGATTCCTGTCTATCTTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023814.2-1255s1c1
Sequence:CCGGCCGTAAAGATTGCGGAGATGACTCGAGTCATCTCCGCAATCTTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023814.2-1978s1c1
Sequence:CCGGCCAGAGTTCTTACAACACCTTCTCGAGAAGGTGTTGTAAGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080508
TBX18 MISSION shRNA Bacterial Glycerol Stock
T-box 18
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080508.1-2400s21c1
Sequence:CCGGATATGACCTTGGGTCTATAAACTCGAGTTTATAGACCCAAGGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080508.1-953s21c1
Sequence:CCGGAGATAGATAGGAATCCATTTGCTCGAGCAAATGGATTCCTATCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080508.1-805s21c1
Sequence:CCGGCGAGTGCACGTCATCCGTAAACTCGAGTTTACGGATGACGTGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080508.1-755s21c1
Sequence:CCGGTGGATGACCAAGGCCATATTACTCGAGTAATATGGCCTTGGTCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080508.1-1578s21c1
Sequence:CCGGCTGTGCACTATATGGATATAACTCGAGTTATATCCATATAGTGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080508
TBX18 MISSION shRNA shRNA Plasmid DNA
T-box 18
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080508.1-2400s21c1
Sequence:CCGGATATGACCTTGGGTCTATAAACTCGAGTTTATAGACCCAAGGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080508.1-953s21c1
Sequence:CCGGAGATAGATAGGAATCCATTTGCTCGAGCAAATGGATTCCTATCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080508.1-805s21c1
Sequence:CCGGCGAGTGCACGTCATCCGTAAACTCGAGTTTACGGATGACGTGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080508.1-755s21c1
Sequence:CCGGTGGATGACCAAGGCCATATTACTCGAGTAATATGGCCTTGGTCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080508.1-1578s21c1
Sequence:CCGGCTGTGCACTATATGGATATAACTCGAGTTATATCCATATAGTGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080508
TBX18 MISSION shRNA Lentiviral Transduction Particles
T-box 18
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080508.1-2400s21c1
Sequence:CCGGATATGACCTTGGGTCTATAAACTCGAGTTTATAGACCCAAGGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080508.1-953s21c1
Sequence:CCGGAGATAGATAGGAATCCATTTGCTCGAGCAAATGGATTCCTATCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080508.1-805s21c1
Sequence:CCGGCGAGTGCACGTCATCCGTAAACTCGAGTTTACGGATGACGTGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080508.1-755s21c1
Sequence:CCGGTGGATGACCAAGGCCATATTACTCGAGTAATATGGCCTTGGTCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080508.1-1578s21c1
Sequence:CCGGCTGTGCACTATATGGATATAACTCGAGTTATATCCATATAGTGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks