EMAIL THIS PAGE TO A FRIEND

TBX19

T-box 19

Synonyms: TBS19 TPIT dJ747L4.1
UniProtKB ID: O60806, Q52M53
Gene ID:
Human(9095) Summary: This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. Mutations in this gene were found in patients with isolated deficiency of pituitary POMC-derived ACTH, suggesting an essential role for this gene in differentiation of the pituitary POMC lineage. ACTH deficiency is characterized by adrenal insufficiency symptoms such as weight loss, lack of appetite (anorexia), weakness, nausea, vomiting, and low blood pressure. [provided by RefSeq, Jul 2008]
Mouse(83993) T-box 19
Rat(304935) T-box 19
cow(514352) T-box 19
sheep(101118399) T-box 19
chicken(395793) T-box 19
dog(449029) T-box 19
Gene Class: ATPase
123 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA005800 Anti-TBX19 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human
immunohistochemistry pricing
AV32364 Anti-TBX19 antibody produced in rabbit affinity isolated antibody canine, rabbit, horse, human, mouse, guinea pig, bovine
western blot pricing
AV32363 Anti-TBX19 antibody produced in rabbit IgG fraction of antiserum bovine, guinea pig, zebrafish, horse, mouse, canine, human, rabbit, rat
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032005 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_032005 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_032005 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005149 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005149 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005149 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005149 Rosetta Predictions human pricing
NM_001107193 Rosetta Predictions rat pricing
NM_032005 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005149 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174429 predicted 549
2 SASI_Hs01_00174430 predicted 1181
3 SASI_Hs01_00174431 predicted 201
4 SASI_Hs01_00174432 predicted 629
5 SASI_Hs01_00174433 predicted 594
6 SASI_Hs01_00174435 predicted 323
7 SASI_Hs01_00174436 predicted 577
8 SASI_Hs01_00174437 predicted 201
9 SASI_Hs01_00174438 predicted 1456
10 SASI_Hs02_00339085 predicted 881
11 SASI_Hs01_00174434 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107193 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226425 predicted 781
2 SASI_Rn02_00226426 predicted 390
3 SASI_Rn02_00226427 predicted 1034
4 SASI_Rn02_00226428 predicted 794
5 SASI_Rn02_00226429 predicted 347
6 SASI_Rn02_00226430 predicted 677
7 SASI_Rn02_00226431 predicted 660
8 SASI_Rn02_00226432 predicted 442
9 SASI_Rn02_00226433 predicted 623
10 SASI_Rn02_00226434 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032005 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075563 predicted 1585
2 SASI_Mm01_00075564 predicted 800
3 SASI_Mm01_00075565 predicted 1620
4 SASI_Mm01_00075567 predicted 388
5 SASI_Mm01_00075568 predicted 359
6 SASI_Mm01_00075569 predicted 1359
7 SASI_Mm01_00075570 predicted 973
8 SASI_Mm01_00075571 predicted 865
9 SASI_Mm01_00075572 predicted 1340
10 SASI_Mm02_00337218 predicted 664
11 SASI_Mm01_00075566 predicted 414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032005
TBX19 MISSION shRNA Bacterial Glycerol Stock
T-box 19
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032005.4-658s21c1
Sequence:CCGGCAATGGAGGTGGGCAGATAATCTCGAGATTATCTGCCCACCTCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032005.4-362s21c1
Sequence:CCGGAGATTCAAGGAAGTCACTAATCTCGAGATTAGTGACTTCCTTGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032005.4-2036s21c1
Sequence:CCGGCAACAGCAAGCTAGTACTAACCTCGAGGTTAGTACTAGCTTGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032005.4-1532s21c1
Sequence:CCGGTCCTCTTCATTGGATAGTTAGCTCGAGCTAACTATCCAATGAAGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032005.2-1117s1c1
Sequence:CCGGCCCTCAGTGAATTTGATAGAACTCGAGTTCTATCAAATTCACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032005.2-709s1c1
Sequence:CCGGCAGGTTCATATAGTCCGTGTTCTCGAGAACACGGACTATATGAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032005.2-2511s1c1
Sequence:CCGGCGCCTCATTCTGCCTTATATTCTCGAGAATATAAGGCAGAATGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032005.2-979s1c1
Sequence:CCGGGCAAACAGCAATTACCAGTATCTCGAGATACTGGTAATTGCTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032005.2-694s1c1
Sequence:CCGGCATAAATATGAACCTCAGGTTCTCGAGAACCTGAGGTTCATATTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032005
TBX19 MISSION shRNA shRNA Plasmid DNA
T-box 19
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032005.4-658s21c1
Sequence:CCGGCAATGGAGGTGGGCAGATAATCTCGAGATTATCTGCCCACCTCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032005.4-362s21c1
Sequence:CCGGAGATTCAAGGAAGTCACTAATCTCGAGATTAGTGACTTCCTTGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032005.4-2036s21c1
Sequence:CCGGCAACAGCAAGCTAGTACTAACCTCGAGGTTAGTACTAGCTTGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032005.4-1532s21c1
Sequence:CCGGTCCTCTTCATTGGATAGTTAGCTCGAGCTAACTATCCAATGAAGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032005.2-1117s1c1
Sequence:CCGGCCCTCAGTGAATTTGATAGAACTCGAGTTCTATCAAATTCACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032005.2-709s1c1
Sequence:CCGGCAGGTTCATATAGTCCGTGTTCTCGAGAACACGGACTATATGAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032005.2-2511s1c1
Sequence:CCGGCGCCTCATTCTGCCTTATATTCTCGAGAATATAAGGCAGAATGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032005.2-979s1c1
Sequence:CCGGGCAAACAGCAATTACCAGTATCTCGAGATACTGGTAATTGCTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032005.2-694s1c1
Sequence:CCGGCATAAATATGAACCTCAGGTTCTCGAGAACCTGAGGTTCATATTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032005
TBX19 MISSION shRNA Lentiviral Transduction Particles
T-box 19
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032005.4-658s21c1
Sequence:CCGGCAATGGAGGTGGGCAGATAATCTCGAGATTATCTGCCCACCTCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032005.4-362s21c1
Sequence:CCGGAGATTCAAGGAAGTCACTAATCTCGAGATTAGTGACTTCCTTGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032005.4-2036s21c1
Sequence:CCGGCAACAGCAAGCTAGTACTAACCTCGAGGTTAGTACTAGCTTGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032005.4-1532s21c1
Sequence:CCGGTCCTCTTCATTGGATAGTTAGCTCGAGCTAACTATCCAATGAAGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032005.2-1117s1c1
Sequence:CCGGCCCTCAGTGAATTTGATAGAACTCGAGTTCTATCAAATTCACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032005.2-709s1c1
Sequence:CCGGCAGGTTCATATAGTCCGTGTTCTCGAGAACACGGACTATATGAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032005.2-2511s1c1
Sequence:CCGGCGCCTCATTCTGCCTTATATTCTCGAGAATATAAGGCAGAATGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032005.2-979s1c1
Sequence:CCGGGCAAACAGCAATTACCAGTATCTCGAGATACTGGTAATTGCTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032005.2-694s1c1
Sequence:CCGGCATAAATATGAACCTCAGGTTCTCGAGAACCTGAGGTTCATATTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005149
VALIDATED
TBX19 MISSION shRNA Bacterial Glycerol Stock
T-box 19
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005149.2-2025s21c1
Sequence:CCGGATAACTGGGTGTGGTAGTTTACTCGAGTAAACTACCACACCCAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005149.2-638s21c1
Sequence:GTACCGGCCTATCAGAATGAGGAGATAACTCGAGTTATCTCCTCATTCTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005149.2-824s21c1
Sequence:GTACCGGGAAACTCCAATTACCAGTATGCTCGAGCATACTGGTAATTGGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005149.2-879s21c1
Sequence:CCGGCCATGGCTGTGAGCACTATTCCTCGAGGAATAGTGCTCACAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005149.2-245s21c1
Sequence:CCGGAGAATGGCAGACGGATGTTTCCTCGAGGAAACATCCGTCTGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005149.1-1680s1c1
Sequence:CCGGCCCTGCCTCTTATTCTCAAATCTCGAGATTTGAGAATAAGAGGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_005149.1-706s1c1
Sequence:CCGGGCCAAGGAAAGAAATCACCTACTCGAGTAGGTGATTTCTTTCCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005149.1-254s1c1
Sequence:CCGGGACGGATGTTTCCAGTCCTAACTCGAGTTAGGACTGGAAACATCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005149.1-217s1c1
Sequence:CCGGGAAGTCACTAATGAGATGATTCTCGAGAATCATCTCATTAGTGACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_005149.1-962s1c1
Sequence:CCGGCCTCAGTGAATTTGATAGAAACTCGAGTTTCTATCAAATTCACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005149
VALIDATED
TBX19 MISSION shRNA shRNA Plasmid DNA
T-box 19
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005149.2-2025s21c1
Sequence:CCGGATAACTGGGTGTGGTAGTTTACTCGAGTAAACTACCACACCCAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005149.2-638s21c1
Sequence:GTACCGGCCTATCAGAATGAGGAGATAACTCGAGTTATCTCCTCATTCTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005149.2-824s21c1
Sequence:GTACCGGGAAACTCCAATTACCAGTATGCTCGAGCATACTGGTAATTGGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005149.2-879s21c1
Sequence:CCGGCCATGGCTGTGAGCACTATTCCTCGAGGAATAGTGCTCACAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005149.2-245s21c1
Sequence:CCGGAGAATGGCAGACGGATGTTTCCTCGAGGAAACATCCGTCTGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005149.1-1680s1c1
Sequence:CCGGCCCTGCCTCTTATTCTCAAATCTCGAGATTTGAGAATAAGAGGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_005149.1-706s1c1
Sequence:CCGGGCCAAGGAAAGAAATCACCTACTCGAGTAGGTGATTTCTTTCCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005149.1-254s1c1
Sequence:CCGGGACGGATGTTTCCAGTCCTAACTCGAGTTAGGACTGGAAACATCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005149.1-217s1c1
Sequence:CCGGGAAGTCACTAATGAGATGATTCTCGAGAATCATCTCATTAGTGACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_005149.1-962s1c1
Sequence:CCGGCCTCAGTGAATTTGATAGAAACTCGAGTTTCTATCAAATTCACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005149
VALIDATED
TBX19 MISSION shRNA Lentiviral Transduction Particles
T-box 19
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005149.2-2025s21c1
Sequence:CCGGATAACTGGGTGTGGTAGTTTACTCGAGTAAACTACCACACCCAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005149.2-638s21c1
Sequence:GTACCGGCCTATCAGAATGAGGAGATAACTCGAGTTATCTCCTCATTCTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005149.2-824s21c1
Sequence:GTACCGGGAAACTCCAATTACCAGTATGCTCGAGCATACTGGTAATTGGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005149.2-879s21c1
Sequence:CCGGCCATGGCTGTGAGCACTATTCCTCGAGGAATAGTGCTCACAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005149.2-245s21c1
Sequence:CCGGAGAATGGCAGACGGATGTTTCCTCGAGGAAACATCCGTCTGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005149.1-1680s1c1
Sequence:CCGGCCCTGCCTCTTATTCTCAAATCTCGAGATTTGAGAATAAGAGGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_005149.1-706s1c1
Sequence:CCGGGCCAAGGAAAGAAATCACCTACTCGAGTAGGTGATTTCTTTCCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005149.1-254s1c1
Sequence:CCGGGACGGATGTTTCCAGTCCTAACTCGAGTTAGGACTGGAAACATCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005149.1-217s1c1
Sequence:CCGGGAAGTCACTAATGAGATGATTCTCGAGAATCATCTCATTAGTGACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_005149.1-962s1c1
Sequence:CCGGCCTCAGTGAATTTGATAGAAACTCGAGTTTCTATCAAATTCACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks