EMAIL THIS PAGE TO A FRIEND

TBX1

T-box 1

Synonyms: CAFS CTHM DGCR DGS DORV TBX1C TGA VCFS
UniProtKB ID: O43435, C6G493, C6G494, O43436, Q96RJ2
Gene ID:
Human(6899) Summary: This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene product shares 98% amino acid sequence identity with the mouse ortholog. DiGeorge syndrome (DGS)/velocardiofacial syndrome (VCFS), a common congenital disorder characterized by neural-crest-related developmental defects, has been associated with deletions of chromosome 22q11.2, where this gene has been mapped. Studies using mouse models of DiGeorge syndrome suggest a major role for this gene in the molecular etiology of DGS/VCFS. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(21380) T-box 1
Rat(360737) T-box 1
chicken(771328) T-box 1
dog(608214) T-box 1
cow(789959) T-box 1
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011532 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011532 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011532 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005992 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005992 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005992 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005992 Rosetta Predictions human pricing
NM_080646 Rosetta Predictions human pricing
NM_080647 Rosetta Predictions human pricing
NM_001108322 Rosetta Predictions rat pricing
NM_011532 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005992 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208003 predicted 838
2 SASI_Hs01_00208004 predicted 588
3 SASI_Hs01_00208005 predicted 877
4 SASI_Hs01_00208006 predicted 798
5 SASI_Hs01_00208007 predicted 870
6 SASI_Hs01_00208009 predicted 872
7 SASI_Hs01_00208010 predicted 872
8 SASI_Hs01_00208011 predicted 881
9 SASI_Hs01_00208012 predicted 779
10 SASI_Hs02_00340686 predicted 910
11 SASI_Hs01_00208008 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141528 predicted 839
2 SASI_Hs01_00141529 predicted 589
3 SASI_Hs01_00141530 predicted 882
4 SASI_Hs01_00141531 predicted 796
5 SASI_Hs01_00141532 predicted 863
6 SASI_Hs01_00141534 predicted 870
7 SASI_Hs01_00141535 predicted 867
8 SASI_Hs01_00141536 predicted 887
9 SASI_Hs01_00141537 predicted 779
10 SASI_Hs02_00362388 predicted 905
11 SASI_Hs01_00141533 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195906 predicted 841
2 SASI_Hs01_00195907 predicted 580
3 SASI_Hs01_00195908 predicted 880
4 SASI_Hs01_00195909 predicted 796
5 SASI_Hs01_00195910 predicted 864
6 SASI_Hs01_00195912 predicted 872
7 SASI_Hs01_00195913 predicted 869
8 SASI_Hs01_00195914 predicted 881
9 SASI_Hs01_00195915 predicted 775
10 SASI_Hs02_00362389 predicted 908
11 SASI_Hs01_00195911 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108322 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237519 predicted 762
2 SASI_Rn02_00237520 predicted 448
3 SASI_Rn02_00237521 predicted 928
4 SASI_Rn02_00237522 predicted 558
5 SASI_Rn02_00237523 predicted 776
6 SASI_Rn02_00237524 predicted 1092
7 SASI_Rn02_00237525 predicted 1044
8 SASI_Rn02_00237526 predicted 450
9 SASI_Rn02_00237527 predicted 582
10 SASI_Rn02_00237528 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011532 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032933 predicted 969
2 SASI_Mm01_00032934 predicted 478
3 SASI_Mm01_00032935 predicted 859
4 SASI_Mm01_00032936 predicted 909
5 SASI_Mm01_00032938 predicted 627
6 SASI_Mm01_00032939 predicted 1010
7 SASI_Mm01_00032940 predicted 512
8 SASI_Mm01_00032941 predicted 701
9 SASI_Mm01_00032942 predicted 853
10 SASI_Mm02_00320852 predicted 577
11 SASI_Mm01_00032937 predicted 698
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011532
TBX1 MISSION shRNA Bacterial Glycerol Stock
T-box 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011532.1-1013s21c1
Sequence:CCGGAGCCCAATGGCTCAGACAAAGCTCGAGCTTTGTCTGAGCCATTGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011532.1-491s21c1
Sequence:CCGGACATGCTGCTCATGGACTTTGCTCGAGCAAAGTCCATGAGCAGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011532.1-1598s1c1
Sequence:CCGGCGGAAGGAAGTGGTATTTATTCTCGAGAATAAATACCACTTCCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011532.1-530s1c1
Sequence:CCGGGCTACCGGTATGCTTTCCATACTCGAGTATGGAAAGCATACCGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011532.1-676s1c1
Sequence:CCGGCTGACCAATAACCTGCTGGATCTCGAGATCCAGCAGGTTATTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011532.1-1245s1c1
Sequence:CCGGGCACCACCATCCCTACAAGTACTCGAGTACTTGTAGGGATGGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011532.1-654s1c1
Sequence:CCGGTGTGTCTTTCGACAAGCTGAACTCGAGTTCAGCTTGTCGAAAGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011532
TBX1 MISSION shRNA shRNA Plasmid DNA
T-box 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011532.1-1013s21c1
Sequence:CCGGAGCCCAATGGCTCAGACAAAGCTCGAGCTTTGTCTGAGCCATTGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011532.1-491s21c1
Sequence:CCGGACATGCTGCTCATGGACTTTGCTCGAGCAAAGTCCATGAGCAGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011532.1-1598s1c1
Sequence:CCGGCGGAAGGAAGTGGTATTTATTCTCGAGAATAAATACCACTTCCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011532.1-530s1c1
Sequence:CCGGGCTACCGGTATGCTTTCCATACTCGAGTATGGAAAGCATACCGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011532.1-676s1c1
Sequence:CCGGCTGACCAATAACCTGCTGGATCTCGAGATCCAGCAGGTTATTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011532.1-1245s1c1
Sequence:CCGGGCACCACCATCCCTACAAGTACTCGAGTACTTGTAGGGATGGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011532.1-654s1c1
Sequence:CCGGTGTGTCTTTCGACAAGCTGAACTCGAGTTCAGCTTGTCGAAAGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011532
TBX1 MISSION shRNA Lentiviral Transduction Particles
T-box 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011532.1-1013s21c1
Sequence:CCGGAGCCCAATGGCTCAGACAAAGCTCGAGCTTTGTCTGAGCCATTGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011532.1-491s21c1
Sequence:CCGGACATGCTGCTCATGGACTTTGCTCGAGCAAAGTCCATGAGCAGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011532.1-1598s1c1
Sequence:CCGGCGGAAGGAAGTGGTATTTATTCTCGAGAATAAATACCACTTCCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011532.1-530s1c1
Sequence:CCGGGCTACCGGTATGCTTTCCATACTCGAGTATGGAAAGCATACCGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011532.1-676s1c1
Sequence:CCGGCTGACCAATAACCTGCTGGATCTCGAGATCCAGCAGGTTATTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011532.1-1245s1c1
Sequence:CCGGGCACCACCATCCCTACAAGTACTCGAGTACTTGTAGGGATGGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011532.1-654s1c1
Sequence:CCGGTGTGTCTTTCGACAAGCTGAACTCGAGTTCAGCTTGTCGAAAGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005992
VALIDATED
TBX1 MISSION shRNA Bacterial Glycerol Stock
T-box 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005992.1-1352s21c1
Sequence:CCGGGGTGGAAGCAGTTCACTTAAACTCGAGTTTAAGTGAACTGCTTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005992.1-968s21c1
Sequence:CCGGGGATCACGCAGCTCAAGATTGCTCGAGCAATCTTGAGCTGCGTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005992.1-874s21c1
Sequence:CCGGCGCAAAGATAGCGAGAAATATCTCGAGATATTTCTCGCTATCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_005992.1-578s21c1
Sequence:CCGGTGGATCCCATGGCCGACTATACTCGAGTATAGTCGGCCATGGGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_005992.1-798s21c1
Sequence:CCGGGGACGACAACGGCCACATTATCTCGAGATAATGTGGCCGTTGTCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005992.1-1351s1c1
Sequence:CCGGTGGTGGAAGCAGTTCACTTAACTCGAGTTAAGTGAACTGCTTCCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005992.1-426s1c1
Sequence:CCGGGCCGGTGAAGAAGAACGCGAACTCGAGTTCGCGTTCTTCTTCACCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005992.1-976s1c1
Sequence:CCGGCAGCTCAAGATTGCCAGCAATCTCGAGATTGCTGGCAATCTTGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005992.1-871s1c1
Sequence:CCGGCCACGCAAAGATAGCGAGAAACTCGAGTTTCTCGCTATCTTTGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005992.1-885s1c1
Sequence:CCGGCGAGAAATATGCCGAGGAGAACTCGAGTTCTCCTCGGCATATTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005992
VALIDATED
TBX1 MISSION shRNA shRNA Plasmid DNA
T-box 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005992.1-1352s21c1
Sequence:CCGGGGTGGAAGCAGTTCACTTAAACTCGAGTTTAAGTGAACTGCTTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005992.1-968s21c1
Sequence:CCGGGGATCACGCAGCTCAAGATTGCTCGAGCAATCTTGAGCTGCGTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005992.1-874s21c1
Sequence:CCGGCGCAAAGATAGCGAGAAATATCTCGAGATATTTCTCGCTATCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_005992.1-578s21c1
Sequence:CCGGTGGATCCCATGGCCGACTATACTCGAGTATAGTCGGCCATGGGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_005992.1-798s21c1
Sequence:CCGGGGACGACAACGGCCACATTATCTCGAGATAATGTGGCCGTTGTCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005992.1-1351s1c1
Sequence:CCGGTGGTGGAAGCAGTTCACTTAACTCGAGTTAAGTGAACTGCTTCCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005992.1-426s1c1
Sequence:CCGGGCCGGTGAAGAAGAACGCGAACTCGAGTTCGCGTTCTTCTTCACCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005992.1-976s1c1
Sequence:CCGGCAGCTCAAGATTGCCAGCAATCTCGAGATTGCTGGCAATCTTGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005992.1-871s1c1
Sequence:CCGGCCACGCAAAGATAGCGAGAAACTCGAGTTTCTCGCTATCTTTGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005992.1-885s1c1
Sequence:CCGGCGAGAAATATGCCGAGGAGAACTCGAGTTCTCCTCGGCATATTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005992
VALIDATED
TBX1 MISSION shRNA Lentiviral Transduction Particles
T-box 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005992.1-1352s21c1
Sequence:CCGGGGTGGAAGCAGTTCACTTAAACTCGAGTTTAAGTGAACTGCTTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005992.1-968s21c1
Sequence:CCGGGGATCACGCAGCTCAAGATTGCTCGAGCAATCTTGAGCTGCGTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005992.1-874s21c1
Sequence:CCGGCGCAAAGATAGCGAGAAATATCTCGAGATATTTCTCGCTATCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_005992.1-578s21c1
Sequence:CCGGTGGATCCCATGGCCGACTATACTCGAGTATAGTCGGCCATGGGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_005992.1-798s21c1
Sequence:CCGGGGACGACAACGGCCACATTATCTCGAGATAATGTGGCCGTTGTCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005992.1-1351s1c1
Sequence:CCGGTGGTGGAAGCAGTTCACTTAACTCGAGTTAAGTGAACTGCTTCCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005992.1-426s1c1
Sequence:CCGGGCCGGTGAAGAAGAACGCGAACTCGAGTTCGCGTTCTTCTTCACCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005992.1-976s1c1
Sequence:CCGGCAGCTCAAGATTGCCAGCAATCTCGAGATTGCTGGCAATCTTGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005992.1-871s1c1
Sequence:CCGGCCACGCAAAGATAGCGAGAAACTCGAGTTTCTCGCTATCTTTGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005992.1-885s1c1
Sequence:CCGGCGAGAAATATGCCGAGGAGAACTCGAGTTCTCCTCGGCATATTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks