EMAIL THIS PAGE TO A FRIEND

TBX20

T-box 20

Synonyms: ASD4
UniProtKB ID: Q9UMR3, A4D1Y6, Q000T4, Q0IJ70, Q0VAS1, Q9Y2N5
Gene ID:
Human(57057) Summary: This gene encodes a T-box family member. The T-box family members share a common DNA binding domain, termed the T-box, and they are transcription factors involved in the regulation of developmental processes. This gene is essential for heart development. Mutations in this gene are associated with diverse cardiac pathologies, including defects in septation, valvulogenesis and cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(57246) T-box 20
Rat(315497) T-box 20
cow(539419) T-box 20
sheep(101117663) T-box 20
Zebrafish(57936) T-box 20
Horse(100070390) T-box 20
dog(482396) T-box transcription factor TBX20-like
chicken(373943) T-box 20
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV33177 Anti-TBX20 (AB1) antibody produced in rabbit affinity isolated antibody zebrafish, canine, bovine, mouse, rat, human, horse, guinea pig, rabbit
immunohistochemistry, western blot pricing
SAB1409545 Anti-TBX20 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
HPA008192 Anti-TBX20 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020496 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020496 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020496 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001166220 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001166220 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001166220 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020417 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU035531 MISSION® esiRNA esiRNA targeting mouse Tbx20 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077653 Rosetta Predictions human pricing
NM_020417 Rosetta Predictions human pricing
NM_001108132 Rosetta Predictions rat pricing
NM_020496 Rosetta Predictions mouse pricing
NM_194263 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313057 predicted 323
2 SASI_Hs02_00313058 predicted 650
3 SASI_Hs02_00313059 predicted 582
4 SASI_Hs02_00313060 predicted 668
5 SASI_Hs02_00313061 predicted 460
6 SASI_Hs02_00313062 predicted 423
7 SASI_Hs02_00313063 predicted 646
8 SASI_Hs02_00313064 predicted 558
9 SASI_Hs02_00313065 predicted 467
10 SASI_Hs02_00313066 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216007 predicted 320
2 SASI_Hs01_00216008 predicted 649
3 SASI_Hs01_00216009 predicted 585
4 SASI_Hs01_00216010 predicted 664
5 SASI_Hs01_00216011 predicted 454
6 SASI_Hs01_00216012 predicted 423
7 SASI_Hs01_00216013 predicted 643
8 SASI_Hs01_00216014 predicted 554
9 SASI_Hs01_00216015 predicted 466
10 SASI_Hs02_00353418 predicted 439
11 SASI_Hs01_00216016 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108132 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235674 predicted 1327
2 SASI_Rn02_00235675 predicted 676
3 SASI_Rn02_00235676 predicted 1433
4 SASI_Rn02_00235677 predicted 1151
5 SASI_Rn02_00235678 predicted 1354
6 SASI_Rn02_00235679 predicted 1040
7 SASI_Rn02_00235680 predicted 1462
8 SASI_Rn02_00235681 predicted 408
9 SASI_Rn02_00235682 predicted 1194
10 SASI_Rn02_00235683 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020496 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025738 predicted 730
2 SASI_Mm01_00025739 predicted 860
3 SASI_Mm01_00025740 predicted 482
4 SASI_Mm01_00025741 predicted 868
5 SASI_Mm01_00025742 predicted 455
6 SASI_Mm01_00025743 predicted 1086
7 SASI_Mm01_00025744 predicted 1034
8 SASI_Mm02_00325548 predicted 842
9 SASI_Mm01_00025745 predicted 928
10 SASI_Mm01_00025746 predicted 1085
11 SASI_Mm01_00025747 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194263 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037544 predicted 726
2 SASI_Mm01_00037545 predicted 867
3 SASI_Mm01_00037546 predicted 478
4 SASI_Mm01_00037547 predicted 868
5 SASI_Mm01_00037548 predicted 452
6 SASI_Mm01_00037549 predicted 1093
7 SASI_Mm01_00037550 predicted 1041
8 SASI_Mm02_00350598 predicted 837
9 SASI_Mm01_00037551 predicted 931
10 SASI_Mm01_00037552 predicted 1087
11 SASI_Mm01_00037553 predicted 631
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020496
TBX20 MISSION shRNA Bacterial Glycerol Stock
T-box 20
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020496.2-873s21c1
Sequence:CCGGTGGATCCTGAGTCCAAGTATACTCGAGTATACTTGGACTCAGGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020496.2-1410s21c1
Sequence:CCGGCCCATCTTCCTTGACATATTGCTCGAGCAATATGTCAAGGAAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020496.2-1649s1c1
Sequence:CCGGCCCAGTCTCAAGTATTCTCTTCTCGAGAAGAGAATACTTGAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020496.2-1261s1c1
Sequence:CCGGCCAACTGATAACCAAGCTGAACTCGAGTTCAGCTTGGTTATCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020496.2-1042s1c1
Sequence:CCGGCCTCAAACAGATGGTGTCTTTCTCGAGAAAGACACCATCTGTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020496.2-731s1c1
Sequence:CCGGCCCAGCGAAGAGATGGCTAAACTCGAGTTTAGCCATCTCTTCGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020496.2-1198s1c1
Sequence:CCGGAGAAGAATTCAGGACGTTCATCTCGAGATGAACGTCCTGAATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020496
TBX20 MISSION shRNA shRNA Plasmid DNA
T-box 20
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020496.2-873s21c1
Sequence:CCGGTGGATCCTGAGTCCAAGTATACTCGAGTATACTTGGACTCAGGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020496.2-1410s21c1
Sequence:CCGGCCCATCTTCCTTGACATATTGCTCGAGCAATATGTCAAGGAAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020496.2-1649s1c1
Sequence:CCGGCCCAGTCTCAAGTATTCTCTTCTCGAGAAGAGAATACTTGAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020496.2-1261s1c1
Sequence:CCGGCCAACTGATAACCAAGCTGAACTCGAGTTCAGCTTGGTTATCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020496.2-1042s1c1
Sequence:CCGGCCTCAAACAGATGGTGTCTTTCTCGAGAAAGACACCATCTGTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020496.2-731s1c1
Sequence:CCGGCCCAGCGAAGAGATGGCTAAACTCGAGTTTAGCCATCTCTTCGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020496.2-1198s1c1
Sequence:CCGGAGAAGAATTCAGGACGTTCATCTCGAGATGAACGTCCTGAATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020496
TBX20 MISSION shRNA Lentiviral Transduction Particles
T-box 20
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020496.2-873s21c1
Sequence:CCGGTGGATCCTGAGTCCAAGTATACTCGAGTATACTTGGACTCAGGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020496.2-1410s21c1
Sequence:CCGGCCCATCTTCCTTGACATATTGCTCGAGCAATATGTCAAGGAAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020496.2-1649s1c1
Sequence:CCGGCCCAGTCTCAAGTATTCTCTTCTCGAGAAGAGAATACTTGAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020496.2-1261s1c1
Sequence:CCGGCCAACTGATAACCAAGCTGAACTCGAGTTCAGCTTGGTTATCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020496.2-1042s1c1
Sequence:CCGGCCTCAAACAGATGGTGTCTTTCTCGAGAAAGACACCATCTGTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020496.2-731s1c1
Sequence:CCGGCCCAGCGAAGAGATGGCTAAACTCGAGTTTAGCCATCTCTTCGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020496.2-1198s1c1
Sequence:CCGGAGAAGAATTCAGGACGTTCATCTCGAGATGAACGTCCTGAATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001166220
TBX20 MISSION shRNA Bacterial Glycerol Stock
T-box 20
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000414457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166220.1-902s21c1
Sequence:CCGGATCCTGAGGCCAAGTACATAGCTCGAGCTATGTACTTGGCCTCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166220.1-1202s21c1
Sequence:CCGGCCTCATTGCTCAACCTGAAGTCTCGAGACTTCAGGTTGAGCAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166220.1-1163s21c1
Sequence:CCGGAGCCAAGGGTGCACATCATTACTCGAGTAATGATGTGCACCCTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001166220
TBX20 MISSION shRNA shRNA Plasmid DNA
T-box 20
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000414457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166220.1-902s21c1
Sequence:CCGGATCCTGAGGCCAAGTACATAGCTCGAGCTATGTACTTGGCCTCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166220.1-1202s21c1
Sequence:CCGGCCTCATTGCTCAACCTGAAGTCTCGAGACTTCAGGTTGAGCAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166220.1-1163s21c1
Sequence:CCGGAGCCAAGGGTGCACATCATTACTCGAGTAATGATGTGCACCCTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001166220
TBX20 MISSION shRNA Lentiviral Transduction Particles
T-box 20
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000414457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166220.1-902s21c1
Sequence:CCGGATCCTGAGGCCAAGTACATAGCTCGAGCTATGTACTTGGCCTCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166220.1-1202s21c1
Sequence:CCGGCCTCATTGCTCAACCTGAAGTCTCGAGACTTCAGGTTGAGCAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166220.1-1163s21c1
Sequence:CCGGAGCCAAGGGTGCACATCATTACTCGAGTAATGATGTGCACCCTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020417
TBX20 MISSION shRNA Bacterial Glycerol Stock
T-box 20
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020417.1-111s1c1
Sequence:CCGGGCGACGGAGAACACAATCAAACTCGAGTTTGATTGTGTTCTCCGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020417.1-590s1c1
Sequence:CCGGTGAGCAACTACTCAAACAGATCTCGAGATCTGTTTGAGTAGTTGCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020417.1-288s1c1
Sequence:CCGGCCCAGTGAGGAAATGGCCAAACTCGAGTTTGGCCATTTCCTCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020417.1-648s1c1
Sequence:CCGGCTGGATCAACATGGCCATATACTCGAGTATATGGCCATGTTGATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020417.1-328s1c1
Sequence:CCGGCCAAGGAGCTTTGGGACAAATCTCGAGATTTGTCCCAAAGCTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020417
TBX20 MISSION shRNA shRNA Plasmid DNA
T-box 20
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020417.1-111s1c1
Sequence:CCGGGCGACGGAGAACACAATCAAACTCGAGTTTGATTGTGTTCTCCGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020417.1-590s1c1
Sequence:CCGGTGAGCAACTACTCAAACAGATCTCGAGATCTGTTTGAGTAGTTGCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020417.1-288s1c1
Sequence:CCGGCCCAGTGAGGAAATGGCCAAACTCGAGTTTGGCCATTTCCTCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020417.1-648s1c1
Sequence:CCGGCTGGATCAACATGGCCATATACTCGAGTATATGGCCATGTTGATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020417.1-328s1c1
Sequence:CCGGCCAAGGAGCTTTGGGACAAATCTCGAGATTTGTCCCAAAGCTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020417
TBX20 MISSION shRNA Lentiviral Transduction Particles
T-box 20
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020417.1-111s1c1
Sequence:CCGGGCGACGGAGAACACAATCAAACTCGAGTTTGATTGTGTTCTCCGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020417.1-590s1c1
Sequence:CCGGTGAGCAACTACTCAAACAGATCTCGAGATCTGTTTGAGTAGTTGCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020417.1-288s1c1
Sequence:CCGGCCCAGTGAGGAAATGGCCAAACTCGAGTTTGGCCATTTCCTCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020417.1-648s1c1
Sequence:CCGGCTGGATCAACATGGCCATATACTCGAGTATATGGCCATGTTGATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020417.1-328s1c1
Sequence:CCGGCCAAGGAGCTTTGGGACAAATCTCGAGATTTGTCCCAAAGCTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks