EMAIL THIS PAGE TO A FRIEND

TBX21

T-box 21

Synonyms: T-PET T-bet TBET TBLYM
UniProtKB ID: Q9UL17
Gene ID:
Human(30009) Summary: This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is the human ortholog of mouse Tbx21/Tbet gene. Studies in mouse show that Tbx21 protein is a Th1 cell-specific transcription factor that controls the expression of the hallmark Th1 cytokine, interferon-gamma (IFNG). Expression of the human ortholog also correlates with IFNG expression in Th1 and natural killer cells, suggesting a role for this gene in initiating Th1 lineage development from naive Th precursor cells. [provided by RefSeq, Jul 2008]
Mouse(57765) T-box 21
Rat(303496) T-box 21
dog(491044) T-box 21
cow(538933) T-box 21
sheep(101118711) T-box 21
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013351 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013351 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013351 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019507 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019507 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019507 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013351 Rosetta Predictions human pricing
NM_001107043 Rosetta Predictions rat pricing
NM_019507 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134111 predicted 961
2 SASI_Hs01_00134112 predicted 752
3 SASI_Hs01_00134113 predicted 1865
4 SASI_Hs01_00134114 predicted 1409
5 SASI_Hs01_00134115 predicted 1818
6 SASI_Hs01_00134116 predicted 1076
7 SASI_Hs01_00134117 predicted 1010
8 SASI_Hs01_00134118 predicted 1401
9 SASI_Hs01_00134119 predicted 1066
10 SASI_Hs02_00344667 predicted 1845
11 SASI_Hs01_00134110 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107043 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224926 predicted 680
2 SASI_Rn02_00224927 predicted 1440
3 SASI_Rn02_00224928 predicted 682
4 SASI_Rn02_00224929 predicted 1740
5 SASI_Rn02_00224930 predicted 1260
6 SASI_Rn02_00224931 predicted 609
7 SASI_Rn02_00224932 predicted 302
8 SASI_Rn02_00224933 predicted 994
9 SASI_Rn02_00224934 predicted 955
10 SASI_Rn02_00224935 predicted 1282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019507 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033710 predicted 1017
2 SASI_Mm01_00033711 predicted 698
3 SASI_Mm01_00033712 predicted 575
4 SASI_Mm01_00033713 predicted 633
5 SASI_Mm02_00324545 predicted 1996
6 SASI_Mm01_00033714 predicted 1454
7 SASI_Mm01_00033715 predicted 690
8 SASI_Mm01_00033716 predicted 796
9 SASI_Mm01_00033717 predicted 969
10 SASI_Mm01_00033718 predicted 910
11 SASI_Mm01_00033719 predicted 1217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013351
TBX21 MISSION shRNA Bacterial Glycerol Stock
T-box 21
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013351.1-1066s1c1
Sequence:CCGGCGCTTCCAACACGCATATCTTCTCGAGAAGATATGCGTGTTGGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013351.1-643s1c1
Sequence:CCGGCCTGTTGTGGTCCAAGTTTAACTCGAGTTAAACTTGGACCACAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013351.1-1018s1c1
Sequence:CCGGGCTGCATATCGTTGAGGTGAACTCGAGTTCACCTCAACGATATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013351.1-1133s1c1
Sequence:CCGGGCCGAGATTACTCAGCTGAAACTCGAGTTTCAGCTGAGTAATCTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013351.1-913s1c1
Sequence:CCGGCCAGGAAGTTTCATTTGGGAACTCGAGTTCCCAAATGAAACTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013351.1-966s21c1
Sequence:CCGGACAATGTGACCCAGATGATTGCTCGAGCAATCATCTGGGTCACATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013351.1-2042s21c1
Sequence:CCGGGCCCTAACTACAGTCGTTTACCTCGAGGTAAACGACTGTAGTTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013351
TBX21 MISSION shRNA shRNA Plasmid DNA
T-box 21
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013351.1-1066s1c1
Sequence:CCGGCGCTTCCAACACGCATATCTTCTCGAGAAGATATGCGTGTTGGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013351.1-643s1c1
Sequence:CCGGCCTGTTGTGGTCCAAGTTTAACTCGAGTTAAACTTGGACCACAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013351.1-1018s1c1
Sequence:CCGGGCTGCATATCGTTGAGGTGAACTCGAGTTCACCTCAACGATATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013351.1-1133s1c1
Sequence:CCGGGCCGAGATTACTCAGCTGAAACTCGAGTTTCAGCTGAGTAATCTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013351.1-913s1c1
Sequence:CCGGCCAGGAAGTTTCATTTGGGAACTCGAGTTCCCAAATGAAACTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013351.1-966s21c1
Sequence:CCGGACAATGTGACCCAGATGATTGCTCGAGCAATCATCTGGGTCACATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013351.1-2042s21c1
Sequence:CCGGGCCCTAACTACAGTCGTTTACCTCGAGGTAAACGACTGTAGTTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013351
TBX21 MISSION shRNA Lentiviral Transduction Particles
T-box 21
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013351.1-1066s1c1
Sequence:CCGGCGCTTCCAACACGCATATCTTCTCGAGAAGATATGCGTGTTGGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013351.1-643s1c1
Sequence:CCGGCCTGTTGTGGTCCAAGTTTAACTCGAGTTAAACTTGGACCACAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013351.1-1018s1c1
Sequence:CCGGGCTGCATATCGTTGAGGTGAACTCGAGTTCACCTCAACGATATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013351.1-1133s1c1
Sequence:CCGGGCCGAGATTACTCAGCTGAAACTCGAGTTTCAGCTGAGTAATCTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013351.1-913s1c1
Sequence:CCGGCCAGGAAGTTTCATTTGGGAACTCGAGTTCCCAAATGAAACTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013351.1-966s21c1
Sequence:CCGGACAATGTGACCCAGATGATTGCTCGAGCAATCATCTGGGTCACATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013351.1-2042s21c1
Sequence:CCGGGCCCTAACTACAGTCGTTTACCTCGAGGTAAACGACTGTAGTTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019507
TBX21 MISSION shRNA Bacterial Glycerol Stock
T-box 21
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019507.1-2099s1c1
Sequence:CCGGCCCTGTCCAGTCAGTAACTTTCTCGAGAAAGTTACTGACTGGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019507.1-686s1c1
Sequence:CCGGCACAAGCCATTACAGGATGTTCTCGAGAACATCCTGTAATGGCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019507.1-1005s1c1
Sequence:CCGGGCTTCTAACACACACGTCTTTCTCGAGAAAGACGTGTGTGTTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019507.1-1218s1c1
Sequence:CCGGCCTCTTCTATCCAACCAGTATCTCGAGATACTGGTTGGATAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019507.1-1277s1c1
Sequence:CCGGGCCCAAGGATATGATCTCACACTCGAGTGTGAGATCATATCCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019507.2-831s21c1
Sequence:CCGGATGCCAGGGAACCGCTTATATCTCGAGATATAAGCGGTTCCCTGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019507.2-2168s21c1
Sequence:CCGGTTGGTCTGACACCTGTGTTAACTCGAGTTAACACAGGTGTCAGACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019507
TBX21 MISSION shRNA shRNA Plasmid DNA
T-box 21
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019507.1-2099s1c1
Sequence:CCGGCCCTGTCCAGTCAGTAACTTTCTCGAGAAAGTTACTGACTGGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019507.1-686s1c1
Sequence:CCGGCACAAGCCATTACAGGATGTTCTCGAGAACATCCTGTAATGGCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019507.1-1005s1c1
Sequence:CCGGGCTTCTAACACACACGTCTTTCTCGAGAAAGACGTGTGTGTTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019507.1-1218s1c1
Sequence:CCGGCCTCTTCTATCCAACCAGTATCTCGAGATACTGGTTGGATAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019507.1-1277s1c1
Sequence:CCGGGCCCAAGGATATGATCTCACACTCGAGTGTGAGATCATATCCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019507.2-831s21c1
Sequence:CCGGATGCCAGGGAACCGCTTATATCTCGAGATATAAGCGGTTCCCTGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019507.2-2168s21c1
Sequence:CCGGTTGGTCTGACACCTGTGTTAACTCGAGTTAACACAGGTGTCAGACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019507
TBX21 MISSION shRNA Lentiviral Transduction Particles
T-box 21
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019507.1-2099s1c1
Sequence:CCGGCCCTGTCCAGTCAGTAACTTTCTCGAGAAAGTTACTGACTGGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019507.1-686s1c1
Sequence:CCGGCACAAGCCATTACAGGATGTTCTCGAGAACATCCTGTAATGGCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019507.1-1005s1c1
Sequence:CCGGGCTTCTAACACACACGTCTTTCTCGAGAAAGACGTGTGTGTTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019507.1-1218s1c1
Sequence:CCGGCCTCTTCTATCCAACCAGTATCTCGAGATACTGGTTGGATAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019507.1-1277s1c1
Sequence:CCGGGCCCAAGGATATGATCTCACACTCGAGTGTGAGATCATATCCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019507.2-831s21c1
Sequence:CCGGATGCCAGGGAACCGCTTATATCTCGAGATATAAGCGGTTCCCTGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019507.2-2168s21c1
Sequence:CCGGTTGGTCTGACACCTGTGTTAACTCGAGTTAACACAGGTGTCAGACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks