EMAIL THIS PAGE TO A FRIEND

TBX22

T-box 22

Synonyms: ABERS CLPA CPX TBXX dJ795G23.1
UniProtKB ID: Q9Y458, Q5JZ06, Q96LC0, Q9HBF1
Gene ID:
Human(50945) Summary: This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. Mutations in this gene have been associated with the inherited X-linked disorder, Cleft palate with ankyloglossia, and it is believed to play a major role in human palatogenesis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(245572) T-box 22
Rat(302369) T-box 22
cow(100299988) T-box 22
sheep(101107501) T-box 22
chicken(373895) T-box 22
Horse(100072559) T-box 22
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016954 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016954 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016954 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145224 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145224 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145224 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001109878 Rosetta Predictions human pricing
NM_001109879 Rosetta Predictions human pricing
NM_016954 Rosetta Predictions human pricing
NM_001106937 Rosetta Predictions rat pricing
NM_145224 Rosetta Predictions mouse pricing
NM_181319 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324763 predicted 1675
2 SASI_Hs02_00324764 predicted 724
3 SASI_Hs02_00324765 predicted 1346
4 SASI_Hs02_00324766 predicted 1244
5 SASI_Hs02_00324767 predicted 1138
6 SASI_Hs02_00324768 predicted 1676
7 SASI_Hs02_00324769 predicted 1033
8 SASI_Hs02_00324770 predicted 1655
9 SASI_Hs02_00324771 predicted 1528
10 SASI_Hs02_00324772 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324773 predicted 1664
2 SASI_Hs02_00324774 predicted 717
3 SASI_Hs02_00324775 predicted 1348
4 SASI_Hs02_00324776 predicted 1245
5 SASI_Hs02_00324777 predicted 1131
6 SASI_Hs02_00324778 predicted 1676
7 SASI_Hs02_00324779 predicted 1032
8 SASI_Hs02_00324780 predicted 1653
9 SASI_Hs02_00324781 predicted 1526
10 SASI_Hs02_00324782 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349964 predicted 1561
2 SASI_Hs02_00349965 predicted 613
3 SASI_Hs01_00137471 predicted 1247
4 SASI_Hs01_00137472 predicted 1140
5 SASI_Hs01_00137473 predicted 1028
6 SASI_Hs01_00137474 predicted 1574
7 SASI_Hs02_00349966 predicted 930
8 SASI_Hs01_00137476 predicted 1554
9 SASI_Hs02_00349967 predicted 1419
10 SASI_Hs01_00137477 predicted 721
11 SASI_Hs01_00137475 predicted 538
12 SASI_Hs01_00137478 predicted 675
13 SASI_Hs01_00137479 predicted 1644
14 SASI_Hs01_00137480 predicted 1411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106937 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223876 predicted 1148
2 SASI_Rn02_00223877 predicted 1351
3 SASI_Rn02_00223878 predicted 484
4 SASI_Rn02_00223879 predicted 1516
5 SASI_Rn02_00223880 predicted 1626
6 SASI_Rn02_00223881 predicted 511
7 SASI_Rn02_00223882 predicted 1286
8 SASI_Rn02_00223883 predicted 1035
9 SASI_Rn02_00223884 predicted 1341
10 SASI_Rn02_00223885 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145224 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196807 predicted 1037
2 SASI_Mm01_00196808 predicted 1399
3 SASI_Mm01_00196809 predicted 1131
4 SASI_Mm01_00196810 predicted 1447
5 SASI_Mm01_00196811 predicted 1444
6 SASI_Mm01_00196812 predicted 1432
7 SASI_Mm02_00340603 predicted 1387
8 SASI_Mm01_00196815 predicted 1157
9 SASI_Mm01_00196816 predicted 1401
10 SASI_Mm02_00340604 predicted 1265
11 SASI_Mm01_00196813 predicted 1455
12 SASI_Mm01_00196814 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181319 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187682 predicted 908
2 SASI_Mm01_00187683 predicted 650
3 SASI_Mm01_00187684 predicted 951
4 SASI_Mm01_00187685 predicted 947
5 SASI_Mm02_00349672 predicted 910
6 SASI_Mm01_00187687 predicted 1470
7 SASI_Mm01_00187688 predicted 778
8 SASI_Mm01_00187689 predicted 1498
9 SASI_Mm01_00187690 predicted 1456
10 SASI_Mm01_00187691 predicted 831
11 SASI_Mm01_00187686 predicted 970
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016954
TBX22 MISSION shRNA Bacterial Glycerol Stock
T-box 22
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016954.2-350s21c1
Sequence:CCGGTCGGGACTGAGATGATCATTACTCGAGTAATGATCATCTCAGTCCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016954.2-748s21c1
Sequence:CCGGTTGCCCACTGAAGGTGTTAAACTCGAGTTTAACACCTTCAGTGGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016954.2-930s1c1
Sequence:CCGGGCCTTCTTTCACTCTCGATTTCTCGAGAAATCGAGAGTGAAAGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016954.2-619s1c1
Sequence:CCGGCGCATGAAACTCACCAACAATCTCGAGATTGTTGGTGAGTTTCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016954.2-1131s1c1
Sequence:CCGGCCTGCCTCTATGCTACAAGATCTCGAGATCTTGTAGCATAGAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016954.2-1333s1c1
Sequence:CCGGGCACCTAATTCTACCAATCAACTCGAGTTGATTGGTAGAATTAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016954.2-598s1c1
Sequence:CCGGCGGCAGATCATCAGCTTTGATCTCGAGATCAAAGCTGATGATCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016954
TBX22 MISSION shRNA shRNA Plasmid DNA
T-box 22
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016954.2-350s21c1
Sequence:CCGGTCGGGACTGAGATGATCATTACTCGAGTAATGATCATCTCAGTCCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016954.2-748s21c1
Sequence:CCGGTTGCCCACTGAAGGTGTTAAACTCGAGTTTAACACCTTCAGTGGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016954.2-930s1c1
Sequence:CCGGGCCTTCTTTCACTCTCGATTTCTCGAGAAATCGAGAGTGAAAGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016954.2-619s1c1
Sequence:CCGGCGCATGAAACTCACCAACAATCTCGAGATTGTTGGTGAGTTTCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016954.2-1131s1c1
Sequence:CCGGCCTGCCTCTATGCTACAAGATCTCGAGATCTTGTAGCATAGAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016954.2-1333s1c1
Sequence:CCGGGCACCTAATTCTACCAATCAACTCGAGTTGATTGGTAGAATTAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016954.2-598s1c1
Sequence:CCGGCGGCAGATCATCAGCTTTGATCTCGAGATCAAAGCTGATGATCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016954
TBX22 MISSION shRNA Lentiviral Transduction Particles
T-box 22
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016954.2-350s21c1
Sequence:CCGGTCGGGACTGAGATGATCATTACTCGAGTAATGATCATCTCAGTCCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016954.2-748s21c1
Sequence:CCGGTTGCCCACTGAAGGTGTTAAACTCGAGTTTAACACCTTCAGTGGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016954.2-930s1c1
Sequence:CCGGGCCTTCTTTCACTCTCGATTTCTCGAGAAATCGAGAGTGAAAGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016954.2-619s1c1
Sequence:CCGGCGCATGAAACTCACCAACAATCTCGAGATTGTTGGTGAGTTTCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016954.2-1131s1c1
Sequence:CCGGCCTGCCTCTATGCTACAAGATCTCGAGATCTTGTAGCATAGAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016954.2-1333s1c1
Sequence:CCGGGCACCTAATTCTACCAATCAACTCGAGTTGATTGGTAGAATTAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016954.2-598s1c1
Sequence:CCGGCGGCAGATCATCAGCTTTGATCTCGAGATCAAAGCTGATGATCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145224
TBX22 MISSION shRNA Bacterial Glycerol Stock
T-box 22
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145224.1-3126s1c1
Sequence:CCGGCCCTAAATAAACCTAGAGAAACTCGAGTTTCTCTAGGTTTATTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145224.1-1255s1c1
Sequence:CCGGCTACAGAATTTGTCCAACTAACTCGAGTTAGTTGGACAAATTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145224.1-576s1c1
Sequence:CCGGCGGTGGATTCCAAACGCTATACTCGAGTATAGCGTTTGGAATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145224.1-1254s1c1
Sequence:CCGGGCTACAGAATTTGTCCAACTACTCGAGTAGTTGGACAAATTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145224.1-1679s1c1
Sequence:CCGGCCAGCCATTAACCATTACCTTCTCGAGAAGGTAATGGTTAATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145224
TBX22 MISSION shRNA shRNA Plasmid DNA
T-box 22
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145224.1-3126s1c1
Sequence:CCGGCCCTAAATAAACCTAGAGAAACTCGAGTTTCTCTAGGTTTATTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145224.1-1255s1c1
Sequence:CCGGCTACAGAATTTGTCCAACTAACTCGAGTTAGTTGGACAAATTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145224.1-576s1c1
Sequence:CCGGCGGTGGATTCCAAACGCTATACTCGAGTATAGCGTTTGGAATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145224.1-1254s1c1
Sequence:CCGGGCTACAGAATTTGTCCAACTACTCGAGTAGTTGGACAAATTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145224.1-1679s1c1
Sequence:CCGGCCAGCCATTAACCATTACCTTCTCGAGAAGGTAATGGTTAATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145224
TBX22 MISSION shRNA Lentiviral Transduction Particles
T-box 22
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145224.1-3126s1c1
Sequence:CCGGCCCTAAATAAACCTAGAGAAACTCGAGTTTCTCTAGGTTTATTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145224.1-1255s1c1
Sequence:CCGGCTACAGAATTTGTCCAACTAACTCGAGTTAGTTGGACAAATTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145224.1-576s1c1
Sequence:CCGGCGGTGGATTCCAAACGCTATACTCGAGTATAGCGTTTGGAATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145224.1-1254s1c1
Sequence:CCGGGCTACAGAATTTGTCCAACTACTCGAGTAGTTGGACAAATTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145224.1-1679s1c1
Sequence:CCGGCCAGCCATTAACCATTACCTTCTCGAGAAGGTAATGGTTAATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks