EMAIL THIS PAGE TO A FRIEND

TBX2

T-box 2

UniProtKB ID: Q13207, Q16424, Q7Z647
Gene ID:
Human(6909) Summary: This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene product is the human homolog of mouse Tbx2, and shares strong sequence similarity with Drosophila omb protein. Expression studies indicate that this gene may have a potential role in tumorigenesis as an immortalizing agent. Transcript heterogeneity due to alternative polyadenylation has been noted for this gene. [provided by RefSeq, Jul 2008]
Mouse(21385) T-box 2
Rat(303398) T-box 2
chicken(373990) T-box 2
dog(448779) T-box 2
cow(535982) T-box 2
155 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005994 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005994 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005994 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009324 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009324 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009324 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005994 Rosetta Predictions human pricing
NM_001107033 Rosetta Predictions rat pricing
NM_009324 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169003 predicted 2326
2 SASI_Hs01_00169004 predicted 768
3 SASI_Hs02_00340695 predicted 2489
4 SASI_Hs01_00169006 predicted 987
5 SASI_Hs01_00169007 predicted 2321
6 SASI_Hs01_00169008 predicted 1030
7 SASI_Hs02_00340696 predicted 2480
8 SASI_Hs01_00169009 predicted 2321
9 SASI_Hs01_00169010 predicted 914
10 SASI_Hs01_00169012 predicted 1004
11 SASI_Hs01_00169005 predicted 1789
12 SASI_Hs01_00169011 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107033 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224826 predicted 635
2 SASI_Rn02_00224827 predicted 539
3 SASI_Rn02_00224828 predicted 484
4 SASI_Rn02_00224829 predicted 646
5 SASI_Rn02_00224830 predicted 458
6 SASI_Rn02_00224831 predicted 551
7 SASI_Rn02_00224832 predicted 370
8 SASI_Rn02_00224833 predicted 454
9 SASI_Rn02_00224834 predicted 368
10 SASI_Rn02_00224835 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009324 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315876 predicted 2837
2 SASI_Mm01_00166394 predicted 935
3 SASI_Mm02_00315877 predicted 930
4 SASI_Mm02_00315878 predicted 2803
5 SASI_Mm01_00166396 predicted 1041
6 SASI_Mm01_00166400 predicted 977
7 SASI_Mm02_00315879 predicted 2529
8 SASI_Mm02_00315880 predicted 1125
9 SASI_Mm02_00315881 predicted 2813
10 SASI_Mm02_00315882 predicted 1292
11 SASI_Mm01_00166391 predicted 1742
12 SASI_Mm01_00166392 predicted 512
13 SASI_Mm01_00166393 predicted 1705
14 SASI_Mm01_00166395 predicted 1728
15 SASI_Mm01_00166397 predicted 2000
16 SASI_Mm01_00166398 predicted 1716
17 SASI_Mm01_00166399 predicted 818
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005994
VALIDATED
TBX2 MISSION shRNA Bacterial Glycerol Stock
T-box 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005994.3-757s1c1
Sequence:CCGGCCGCTGACGATTGCCGCTATACTCGAGTATAGCGGCAATCGTCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005994.3-914s1c1
Sequence:CCGGGACCAACAACATCTCTGACAACTCGAGTTGTCAGAGATGTTGTTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005994.3-2262s1c1
Sequence:CCGGGAGCTGGCTCTCCGCAAAGTACTCGAGTACTTTGCGGAGAGCCAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005994.3-3050s1c1
Sequence:CCGGCCCAGAATATGCAAATTGGTACTCGAGTACCAATTTGCATATTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005994.3-935s1c1
Sequence:CCGGGCACGGCTTCACCATCCTAAACTCGAGTTTAGGATGGTGAAGCCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005994.3-2490s21c1
Sequence:CCGGACAGCACAGAATGAGTATTTACTCGAGTAAATACTCATTCTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005994.3-1105s21c1
Sequence:CCGGAGATCGACAACAACCCGTTTGCTCGAGCAAACGGGTTGTTGTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005994.3-935s21c1
Sequence:CCGGGCACGGCTTCACCATCCTAAACTCGAGTTTAGGATGGTGAAGCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005994.3-821s21c1
Sequence:CCGGTGAGATGCCCAAACGCATGTACTCGAGTACATGCGTTTGGGCATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005994.3-758s21c1
Sequence:CCGGCGCTGACGATTGCCGCTATAACTCGAGTTATAGCGGCAATCGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005994
VALIDATED
TBX2 MISSION shRNA shRNA Plasmid DNA
T-box 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005994.3-757s1c1
Sequence:CCGGCCGCTGACGATTGCCGCTATACTCGAGTATAGCGGCAATCGTCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005994.3-914s1c1
Sequence:CCGGGACCAACAACATCTCTGACAACTCGAGTTGTCAGAGATGTTGTTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005994.3-2262s1c1
Sequence:CCGGGAGCTGGCTCTCCGCAAAGTACTCGAGTACTTTGCGGAGAGCCAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005994.3-3050s1c1
Sequence:CCGGCCCAGAATATGCAAATTGGTACTCGAGTACCAATTTGCATATTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005994.3-935s1c1
Sequence:CCGGGCACGGCTTCACCATCCTAAACTCGAGTTTAGGATGGTGAAGCCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005994.3-2490s21c1
Sequence:CCGGACAGCACAGAATGAGTATTTACTCGAGTAAATACTCATTCTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005994.3-1105s21c1
Sequence:CCGGAGATCGACAACAACCCGTTTGCTCGAGCAAACGGGTTGTTGTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005994.3-935s21c1
Sequence:CCGGGCACGGCTTCACCATCCTAAACTCGAGTTTAGGATGGTGAAGCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005994.3-821s21c1
Sequence:CCGGTGAGATGCCCAAACGCATGTACTCGAGTACATGCGTTTGGGCATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005994.3-758s21c1
Sequence:CCGGCGCTGACGATTGCCGCTATAACTCGAGTTATAGCGGCAATCGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005994
VALIDATED
TBX2 MISSION shRNA Lentiviral Transduction Particles
T-box 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005994.3-757s1c1
Sequence:CCGGCCGCTGACGATTGCCGCTATACTCGAGTATAGCGGCAATCGTCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005994.3-914s1c1
Sequence:CCGGGACCAACAACATCTCTGACAACTCGAGTTGTCAGAGATGTTGTTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005994.3-2262s1c1
Sequence:CCGGGAGCTGGCTCTCCGCAAAGTACTCGAGTACTTTGCGGAGAGCCAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005994.3-3050s1c1
Sequence:CCGGCCCAGAATATGCAAATTGGTACTCGAGTACCAATTTGCATATTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005994.3-935s1c1
Sequence:CCGGGCACGGCTTCACCATCCTAAACTCGAGTTTAGGATGGTGAAGCCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005994.3-2490s21c1
Sequence:CCGGACAGCACAGAATGAGTATTTACTCGAGTAAATACTCATTCTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005994.3-1105s21c1
Sequence:CCGGAGATCGACAACAACCCGTTTGCTCGAGCAAACGGGTTGTTGTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005994.3-935s21c1
Sequence:CCGGGCACGGCTTCACCATCCTAAACTCGAGTTTAGGATGGTGAAGCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005994.3-821s21c1
Sequence:CCGGTGAGATGCCCAAACGCATGTACTCGAGTACATGCGTTTGGGCATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005994.3-758s21c1
Sequence:CCGGCGCTGACGATTGCCGCTATAACTCGAGTTATAGCGGCAATCGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009324
TBX2 MISSION shRNA Bacterial Glycerol Stock
T-box 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009324.1-568s1c1
Sequence:CCGGCGAGATGCCTAAACGCATGTACTCGAGTACATGCGTTTAGGCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009324.1-748s1c1
Sequence:CCGGTGACATCTTGAAGCTCCCATACTCGAGTATGGGAGCTTCAAGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009324.1-941s1c1
Sequence:CCGGCGTTTGTATGAGGAGCACTGTCTCGAGACAGTGCTCCTCATACAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009324.1-514s1c1
Sequence:CCGGCTGCCGCTATAAGTTTCACAACTCGAGTTGTGAAACTTATAGCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009324.1-1842s1c1
Sequence:CCGGGTTCATTATCACGGAGCCCATCTCGAGATGGGCTCCGTGATAATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009324.2-2840s21c1
Sequence:CCGGATCCCTGGATTTGATGCAAATCTCGAGATTTGCATCAAATCCAGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009324.2-2703s21c1
Sequence:CCGGACAGCACAGAATGGGTATTTACTCGAGTAAATACCCATTCTGTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009324.2-936s21c1
Sequence:CCGGAGCCAAATACATCCTGCTAATCTCGAGATTAGCAGGATGTATTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009324
TBX2 MISSION shRNA shRNA Plasmid DNA
T-box 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009324.1-568s1c1
Sequence:CCGGCGAGATGCCTAAACGCATGTACTCGAGTACATGCGTTTAGGCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009324.1-748s1c1
Sequence:CCGGTGACATCTTGAAGCTCCCATACTCGAGTATGGGAGCTTCAAGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009324.1-941s1c1
Sequence:CCGGCGTTTGTATGAGGAGCACTGTCTCGAGACAGTGCTCCTCATACAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009324.1-514s1c1
Sequence:CCGGCTGCCGCTATAAGTTTCACAACTCGAGTTGTGAAACTTATAGCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009324.1-1842s1c1
Sequence:CCGGGTTCATTATCACGGAGCCCATCTCGAGATGGGCTCCGTGATAATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009324.2-2840s21c1
Sequence:CCGGATCCCTGGATTTGATGCAAATCTCGAGATTTGCATCAAATCCAGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009324.2-2703s21c1
Sequence:CCGGACAGCACAGAATGGGTATTTACTCGAGTAAATACCCATTCTGTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009324.2-936s21c1
Sequence:CCGGAGCCAAATACATCCTGCTAATCTCGAGATTAGCAGGATGTATTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009324
TBX2 MISSION shRNA Lentiviral Transduction Particles
T-box 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009324.1-568s1c1
Sequence:CCGGCGAGATGCCTAAACGCATGTACTCGAGTACATGCGTTTAGGCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009324.1-748s1c1
Sequence:CCGGTGACATCTTGAAGCTCCCATACTCGAGTATGGGAGCTTCAAGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009324.1-941s1c1
Sequence:CCGGCGTTTGTATGAGGAGCACTGTCTCGAGACAGTGCTCCTCATACAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009324.1-514s1c1
Sequence:CCGGCTGCCGCTATAAGTTTCACAACTCGAGTTGTGAAACTTATAGCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009324.1-1842s1c1
Sequence:CCGGGTTCATTATCACGGAGCCCATCTCGAGATGGGCTCCGTGATAATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009324.2-2840s21c1
Sequence:CCGGATCCCTGGATTTGATGCAAATCTCGAGATTTGCATCAAATCCAGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009324.2-2703s21c1
Sequence:CCGGACAGCACAGAATGGGTATTTACTCGAGTAAATACCCATTCTGTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009324.2-936s21c1
Sequence:CCGGAGCCAAATACATCCTGCTAATCTCGAGATTAGCAGGATGTATTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks