EMAIL THIS PAGE TO A FRIEND

TBX3

T-box 3

Synonyms: TBX3-ISO UMS XHL
UniProtKB ID: O15119, Q8TB20, Q9UKF8
Gene ID:
Human(6926) Summary: This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This protein is a transcriptional repressor and is thought to play a role in the anterior/posterior axis of the tetrapod forelimb. Mutations in this gene cause ulnar-mammary syndrome, affecting limb, apocrine gland, tooth, hair, and genital development. Alternative splicing of this gene results in three transcript variants encoding different isoforms; however, the full length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
Mouse(21386) T-box 3
Rat(353305) T-box 3
chicken(374202) T-box 3
dog(477494) T-box 3
cow(781063) T-box 3
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016569 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198052 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198052 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198052 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152231 MISSION® esiRNA esiRNA human TBX3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005996 Rosetta Predictions human pricing
NM_016569 Rosetta Predictions human pricing
NM_181638 Rosetta Predictions rat pricing
NM_011535 Rosetta Predictions mouse pricing
NM_198052 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110889 predicted 1870
2 SASI_Hs01_00110890 predicted 1212
3 SASI_Hs01_00110891 predicted 1870
4 SASI_Hs01_00110892 predicted 1976
5 SASI_Hs01_00110893 predicted 1937
6 SASI_Hs01_00110894 predicted 1981
7 SASI_Hs01_00110895 predicted 1285
8 SASI_Hs01_00110896 predicted 1855
9 SASI_Hs01_00110897 predicted 1980
10 SASI_Hs01_00110898 predicted 3018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147492 predicted 1933
2 SASI_Hs01_00147493 predicted 1214
3 SASI_Hs01_00147494 predicted 1929
4 SASI_Hs01_00147495 predicted 2031
5 SASI_Hs01_00147496 predicted 1989
6 SASI_Hs01_00147497 predicted 2035
7 SASI_Hs01_00147498 predicted 1285
8 SASI_Hs01_00147499 predicted 1921
9 SASI_Hs01_00147500 predicted 2041
10 SASI_Hs01_00147501 predicted 3078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181638 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105973 predicted 388
2 SASI_Rn01_00105974 predicted 329
3 SASI_Rn02_00269780 predicted 598
4 SASI_Rn01_00105975 predicted 471
5 SASI_Rn01_00105976 predicted 773
6 SASI_Rn01_00105977 predicted 642
7 SASI_Rn02_00269781 predicted 842
8 SASI_Rn01_00105979 predicted 798
9 SASI_Rn01_00105981 predicted 640
10 SASI_Rn01_00105982 predicted 803
11 SASI_Rn01_00105978 predicted 484
12 SASI_Rn01_00105980 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011535 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170053 predicted 2423
2 SASI_Mm01_00170054 predicted 1667
3 SASI_Mm01_00170055 predicted 2310
4 SASI_Mm02_00320863 predicted 3637
5 SASI_Mm01_00170056 predicted 3717
6 SASI_Mm01_00170058 predicted 1736
7 SASI_Mm01_00170059 predicted 3315
8 SASI_Mm01_00170060 predicted 3734
9 SASI_Mm01_00170061 predicted 1702
10 SASI_Mm01_00170062 predicted 2313
11 SASI_Mm01_00170057 predicted 1739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106378 predicted 2359
2 SASI_Mm01_00106379 predicted 1673
3 SASI_Mm01_00106380 predicted 2251
4 SASI_Mm02_00350795 predicted 3573
5 SASI_Mm01_00106381 predicted 3663
6 SASI_Mm01_00106383 predicted 1731
7 SASI_Mm01_00106384 predicted 3247
8 SASI_Mm01_00106385 predicted 3682
9 SASI_Mm01_00106386 predicted 1700
10 SASI_Mm01_00106387 predicted 2254
11 SASI_Mm01_00106382 predicted 1734
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016569
TBX3 MISSION shRNA Bacterial Glycerol Stock
T-box 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016569.2-730s1c1
Sequence:CCGGGCTGCTGATGACTGTCGTTATCTCGAGATAACGACAGTCATCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016569.2-864s1c1
Sequence:CCGGCGTCACTTTCCACAAACTGAACTCGAGTTCAGTTTGTGGAAAGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016569.2-1108s1c1
Sequence:CCGGGCATACCAGAATGATAAGATACTCGAGTATCTTATCATTCTGGTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016569.2-2230s1c1
Sequence:CCGGCGTGGTTTATATGTCCGGGATCTCGAGATCCCGGACATATAAACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016569.2-443s1c1
Sequence:CCGGCCAAGCCGATCATGGATCAATCTCGAGATTGATCCATGATCGGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016569.3-1354s21c1
Sequence:CCGGGCGAATGTTTCCTCCATTTAACTCGAGTTAAATGGAGGAAACATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016569.3-3535s21c1
Sequence:CCGGTCTCCCTCAGTGCGGATTTATCTCGAGATAAATCCGCACTGAGGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016569
TBX3 MISSION shRNA shRNA Plasmid DNA
T-box 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016569.2-730s1c1
Sequence:CCGGGCTGCTGATGACTGTCGTTATCTCGAGATAACGACAGTCATCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016569.2-864s1c1
Sequence:CCGGCGTCACTTTCCACAAACTGAACTCGAGTTCAGTTTGTGGAAAGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016569.2-1108s1c1
Sequence:CCGGGCATACCAGAATGATAAGATACTCGAGTATCTTATCATTCTGGTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016569.2-2230s1c1
Sequence:CCGGCGTGGTTTATATGTCCGGGATCTCGAGATCCCGGACATATAAACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016569.2-443s1c1
Sequence:CCGGCCAAGCCGATCATGGATCAATCTCGAGATTGATCCATGATCGGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016569.3-1354s21c1
Sequence:CCGGGCGAATGTTTCCTCCATTTAACTCGAGTTAAATGGAGGAAACATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016569.3-3535s21c1
Sequence:CCGGTCTCCCTCAGTGCGGATTTATCTCGAGATAAATCCGCACTGAGGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016569
TBX3 MISSION shRNA Lentiviral Transduction Particles
T-box 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016569.2-730s1c1
Sequence:CCGGGCTGCTGATGACTGTCGTTATCTCGAGATAACGACAGTCATCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016569.2-864s1c1
Sequence:CCGGCGTCACTTTCCACAAACTGAACTCGAGTTCAGTTTGTGGAAAGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016569.2-1108s1c1
Sequence:CCGGGCATACCAGAATGATAAGATACTCGAGTATCTTATCATTCTGGTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016569.2-2230s1c1
Sequence:CCGGCGTGGTTTATATGTCCGGGATCTCGAGATCCCGGACATATAAACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016569.2-443s1c1
Sequence:CCGGCCAAGCCGATCATGGATCAATCTCGAGATTGATCCATGATCGGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016569.3-1354s21c1
Sequence:CCGGGCGAATGTTTCCTCCATTTAACTCGAGTTAAATGGAGGAAACATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016569.3-3535s21c1
Sequence:CCGGTCTCCCTCAGTGCGGATTTATCTCGAGATAAATCCGCACTGAGGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198052
VALIDATED
TBX3 MISSION shRNA Bacterial Glycerol Stock
T-box 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198052.1-3935s1c1
Sequence:CCGGCCTCCTAAACAAACTAACAAACTCGAGTTTGTTAGTTTGTTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198052.1-1737s1c1
Sequence:CCGGGCGAATGTTCCCTCCGTTTAACTCGAGTTAAACGGAGGGAACATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198052.1-2110s1c1
Sequence:CCGGGAAACAGAATTCATCGCCGTTCTCGAGAACGGCGATGAATTCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198052.1-1819s1c1
Sequence:CCGGGCTGACGACTGTCGATATAAACTCGAGTTTATATCGACAGTCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198052.1-2456s1c1
Sequence:CCGGCGGCCAAGATTTCCACCACTACTCGAGTAGTGGTGGAAATCTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198052.1-2110s21c1
Sequence:CCGGGAAACAGAATTCATCGCCGTTCTCGAGAACGGCGATGAATTCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198052.1-1737s21c1
Sequence:CCGGGCGAATGTTCCCTCCGTTTAACTCGAGTTAAACGGAGGGAACATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198052.1-1986s21c1
Sequence:CCGGATCGGATAAACACGGATTTACCTCGAGGTAAATCCGTGTTTATCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198052.1-3553s21c1
Sequence:CCGGTCCATTCCAGTTTGGTCAAATCTCGAGATTTGACCAAACTGGAATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198052.1-1818s21c1
Sequence:CCGGTGCTGACGACTGTCGATATAACTCGAGTTATATCGACAGTCGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198052
VALIDATED
TBX3 MISSION shRNA shRNA Plasmid DNA
T-box 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198052.1-3935s1c1
Sequence:CCGGCCTCCTAAACAAACTAACAAACTCGAGTTTGTTAGTTTGTTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198052.1-1737s1c1
Sequence:CCGGGCGAATGTTCCCTCCGTTTAACTCGAGTTAAACGGAGGGAACATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198052.1-2110s1c1
Sequence:CCGGGAAACAGAATTCATCGCCGTTCTCGAGAACGGCGATGAATTCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198052.1-1819s1c1
Sequence:CCGGGCTGACGACTGTCGATATAAACTCGAGTTTATATCGACAGTCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198052.1-2456s1c1
Sequence:CCGGCGGCCAAGATTTCCACCACTACTCGAGTAGTGGTGGAAATCTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198052.1-2110s21c1
Sequence:CCGGGAAACAGAATTCATCGCCGTTCTCGAGAACGGCGATGAATTCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198052.1-1737s21c1
Sequence:CCGGGCGAATGTTCCCTCCGTTTAACTCGAGTTAAACGGAGGGAACATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198052.1-1986s21c1
Sequence:CCGGATCGGATAAACACGGATTTACCTCGAGGTAAATCCGTGTTTATCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198052.1-3553s21c1
Sequence:CCGGTCCATTCCAGTTTGGTCAAATCTCGAGATTTGACCAAACTGGAATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198052.1-1818s21c1
Sequence:CCGGTGCTGACGACTGTCGATATAACTCGAGTTATATCGACAGTCGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198052
VALIDATED
TBX3 MISSION shRNA Lentiviral Transduction Particles
T-box 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198052.1-3935s1c1
Sequence:CCGGCCTCCTAAACAAACTAACAAACTCGAGTTTGTTAGTTTGTTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198052.1-1737s1c1
Sequence:CCGGGCGAATGTTCCCTCCGTTTAACTCGAGTTAAACGGAGGGAACATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198052.1-2110s1c1
Sequence:CCGGGAAACAGAATTCATCGCCGTTCTCGAGAACGGCGATGAATTCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198052.1-1819s1c1
Sequence:CCGGGCTGACGACTGTCGATATAAACTCGAGTTTATATCGACAGTCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198052.1-2456s1c1
Sequence:CCGGCGGCCAAGATTTCCACCACTACTCGAGTAGTGGTGGAAATCTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198052.1-2110s21c1
Sequence:CCGGGAAACAGAATTCATCGCCGTTCTCGAGAACGGCGATGAATTCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198052.1-1737s21c1
Sequence:CCGGGCGAATGTTCCCTCCGTTTAACTCGAGTTAAACGGAGGGAACATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198052.1-1986s21c1
Sequence:CCGGATCGGATAAACACGGATTTACCTCGAGGTAAATCCGTGTTTATCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198052.1-3553s21c1
Sequence:CCGGTCCATTCCAGTTTGGTCAAATCTCGAGATTTGACCAAACTGGAATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198052.1-1818s21c1
Sequence:CCGGTGCTGACGACTGTCGATATAACTCGAGTTATATCGACAGTCGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks