EMAIL THIS PAGE TO A FRIEND

TBX4

T-box 4

Synonyms: SPS
UniProtKB ID: P57082, B2RMT1
Gene ID:
Human(9496) Summary: This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is the human homolog of mouse Tbx4, which is closely linked to Tbx2 on mouse chromosome 11. Similarly this gene, like TBX2, maps to human chromosome 17. Expression studies in mouse and chicken show that Tbx4 is expressed in developing hindlimb, but not in forelimb buds, suggesting a role for this gene in regulating limb development and specification of limb identity. [provided by RefSeq, Jul 2008]
Mouse(21387) T-box 4
Rat(303399) T-box 4
dog(403514) T-box 4
chicken(373989) T-box 4
cow(508750) T-box 4
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011536 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011536 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011536 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018488 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018488 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018488 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018488 Rosetta Predictions human pricing
NM_001107034 Rosetta Predictions rat pricing
NM_011536 Rosetta Predictions mouse pricing
NM_172798 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196316 predicted 1438
2 SASI_Hs01_00196317 predicted 1214
3 SASI_Hs01_00196318 predicted 587
4 SASI_Hs01_00196319 predicted 223
5 SASI_Hs01_00196320 predicted 726
6 SASI_Hs01_00196321 predicted 2130
7 SASI_Hs01_00196322 predicted 1436
8 SASI_Hs01_00196324 predicted 1318
9 SASI_Hs01_00196325 predicted 1283
10 SASI_Hs02_00352077 predicted 1372
11 SASI_Hs01_00196323 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224836 predicted 2249
2 SASI_Rn02_00224837 predicted 962
3 SASI_Rn02_00224838 predicted 1338
4 SASI_Rn02_00224839 predicted 2252
5 SASI_Rn02_00224840 predicted 1233
6 SASI_Rn02_00224841 predicted 2231
7 SASI_Rn02_00224842 predicted 845
8 SASI_Rn02_00224843 predicted 1301
9 SASI_Rn02_00224844 predicted 1449
10 SASI_Rn02_00224845 predicted 1411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011536 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201206 predicted 808
2 SASI_Mm02_00320864 predicted 2149
3 SASI_Mm01_00201208 predicted 1421
4 SASI_Mm01_00201209 predicted 854
5 SASI_Mm01_00201210 predicted 764
6 SASI_Mm01_00201211 predicted 1413
7 SASI_Mm02_00320865 predicted 1294
8 SASI_Mm01_00201212 predicted 1105
9 SASI_Mm01_00201213 predicted 1141
10 SASI_Mm01_00201214 predicted 1182
11 SASI_Mm01_00201207 predicted 505
12 SASI_Mm01_00201215 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344705 predicted 755
2 SASI_Mm02_00344706 predicted 2104
3 SASI_Mm02_00344707 predicted 1370
4 SASI_Mm02_00344708 predicted 803
5 SASI_Mm02_00344709 predicted 711
6 SASI_Mm02_00344710 predicted 1367
7 SASI_Mm02_00344711 predicted 1251
8 SASI_Mm02_00344712 predicted 1053
9 SASI_Mm02_00344713 predicted 1097
10 SASI_Mm02_00344714 predicted 1140
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011536
VALIDATED
TBX4 MISSION shRNA Bacterial Glycerol Stock
T-box 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011536.2-1655s21c1
Sequence:CCGGGATGACGAGACTACCTGTATCCTCGAGGATACAGGTAGTCTCGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011536.2-1841s21c1
Sequence:CCGGGTCTTCTGACATGCAACTAAGCTCGAGCTTAGTTGCATGTCAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011536.2-442s21c1
Sequence:CCGGGCCATGCCAGGAAGACTTTATCTCGAGATAAAGTCTTCCTGGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011536.2-1602s21c1
Sequence:CCGGGTCATCCTTACAGTATCATTCCTCGAGGAATGATACTGTAAGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011536.1-1158s1c1
Sequence:CCGGCCCTTCTTATTGCAGTGAGGTCTCGAGACCTCACTGCAATAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011536.1-345s1c1
Sequence:CCGGGACCAAGTACATACTTCTCATCTCGAGATGAGAAGTATGTACTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011536.1-1426s1c1
Sequence:CCGGGCCCACTTTAGTGTGTACAATCTCGAGATTGTACACACTAAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011536.1-916s1c1
Sequence:CCGGCAGCACTACCAGTATGAGAATCTCGAGATTCTCATACTGGTAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011536.1-390s1c1
Sequence:CCGGTCGCTACAAGTTCTGTGACAACTCGAGTTGTCACAGAACTTGTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011536
VALIDATED
TBX4 MISSION shRNA shRNA Plasmid DNA
T-box 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011536.2-1655s21c1
Sequence:CCGGGATGACGAGACTACCTGTATCCTCGAGGATACAGGTAGTCTCGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011536.2-1841s21c1
Sequence:CCGGGTCTTCTGACATGCAACTAAGCTCGAGCTTAGTTGCATGTCAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011536.2-442s21c1
Sequence:CCGGGCCATGCCAGGAAGACTTTATCTCGAGATAAAGTCTTCCTGGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011536.2-1602s21c1
Sequence:CCGGGTCATCCTTACAGTATCATTCCTCGAGGAATGATACTGTAAGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011536.1-1158s1c1
Sequence:CCGGCCCTTCTTATTGCAGTGAGGTCTCGAGACCTCACTGCAATAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011536.1-345s1c1
Sequence:CCGGGACCAAGTACATACTTCTCATCTCGAGATGAGAAGTATGTACTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011536.1-1426s1c1
Sequence:CCGGGCCCACTTTAGTGTGTACAATCTCGAGATTGTACACACTAAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011536.1-916s1c1
Sequence:CCGGCAGCACTACCAGTATGAGAATCTCGAGATTCTCATACTGGTAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011536.1-390s1c1
Sequence:CCGGTCGCTACAAGTTCTGTGACAACTCGAGTTGTCACAGAACTTGTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011536
VALIDATED
TBX4 MISSION shRNA Lentiviral Transduction Particles
T-box 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011536.2-1655s21c1
Sequence:CCGGGATGACGAGACTACCTGTATCCTCGAGGATACAGGTAGTCTCGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011536.2-1841s21c1
Sequence:CCGGGTCTTCTGACATGCAACTAAGCTCGAGCTTAGTTGCATGTCAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011536.2-442s21c1
Sequence:CCGGGCCATGCCAGGAAGACTTTATCTCGAGATAAAGTCTTCCTGGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011536.2-1602s21c1
Sequence:CCGGGTCATCCTTACAGTATCATTCCTCGAGGAATGATACTGTAAGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011536.1-1158s1c1
Sequence:CCGGCCCTTCTTATTGCAGTGAGGTCTCGAGACCTCACTGCAATAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011536.1-345s1c1
Sequence:CCGGGACCAAGTACATACTTCTCATCTCGAGATGAGAAGTATGTACTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011536.1-1426s1c1
Sequence:CCGGGCCCACTTTAGTGTGTACAATCTCGAGATTGTACACACTAAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011536.1-916s1c1
Sequence:CCGGCAGCACTACCAGTATGAGAATCTCGAGATTCTCATACTGGTAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011536.1-390s1c1
Sequence:CCGGTCGCTACAAGTTCTGTGACAACTCGAGTTGTCACAGAACTTGTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018488
TBX4 MISSION shRNA Bacterial Glycerol Stock
T-box 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018488.2-1710s21c1
Sequence:CCGGGACCGTGTTGCTCCAGTATTACTCGAGTAATACTGGAGCAACACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018488.2-1928s21c1
Sequence:CCGGAGGACCTGGGTCTATTGTTATCTCGAGATAACAATAGACCCAGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018488.2-1847s21c1
Sequence:CCGGAGCATCCATCTTCTGACATACCTCGAGGTATGTCAGAAGATGGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018488.2-408s21c1
Sequence:CCGGTGCCGATGACCATCGCTACAACTCGAGTTGTAGCGATGGTCATCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018488.2-2252s1c1
Sequence:CCGGGCCACAATGTGTACTTTGATACTCGAGTATCAAAGTACACATTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018488.2-1450s1c1
Sequence:CCGGGCCCACTTTAGTGTCTACAATCTCGAGATTGTAGACACTAAAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018488.2-228s1c1
Sequence:CCGGGCAGACCATCGAGAACATCAACTCGAGTTGATGTTCTCGATGGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018488.2-1567s1c1
Sequence:CCGGCCACATCTAAATGCTGCCAATCTCGAGATTGGCAGCATTTAGATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018488.2-1620s1c1
Sequence:CCGGCCGAGAATCTTCCTTACAGTACTCGAGTACTGTAAGGAAGATTCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018488
TBX4 MISSION shRNA shRNA Plasmid DNA
T-box 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018488.2-1710s21c1
Sequence:CCGGGACCGTGTTGCTCCAGTATTACTCGAGTAATACTGGAGCAACACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018488.2-1928s21c1
Sequence:CCGGAGGACCTGGGTCTATTGTTATCTCGAGATAACAATAGACCCAGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018488.2-1847s21c1
Sequence:CCGGAGCATCCATCTTCTGACATACCTCGAGGTATGTCAGAAGATGGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018488.2-408s21c1
Sequence:CCGGTGCCGATGACCATCGCTACAACTCGAGTTGTAGCGATGGTCATCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018488.2-2252s1c1
Sequence:CCGGGCCACAATGTGTACTTTGATACTCGAGTATCAAAGTACACATTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018488.2-1450s1c1
Sequence:CCGGGCCCACTTTAGTGTCTACAATCTCGAGATTGTAGACACTAAAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018488.2-228s1c1
Sequence:CCGGGCAGACCATCGAGAACATCAACTCGAGTTGATGTTCTCGATGGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018488.2-1567s1c1
Sequence:CCGGCCACATCTAAATGCTGCCAATCTCGAGATTGGCAGCATTTAGATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018488.2-1620s1c1
Sequence:CCGGCCGAGAATCTTCCTTACAGTACTCGAGTACTGTAAGGAAGATTCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018488
TBX4 MISSION shRNA Lentiviral Transduction Particles
T-box 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018488.2-1710s21c1
Sequence:CCGGGACCGTGTTGCTCCAGTATTACTCGAGTAATACTGGAGCAACACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018488.2-1928s21c1
Sequence:CCGGAGGACCTGGGTCTATTGTTATCTCGAGATAACAATAGACCCAGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018488.2-1847s21c1
Sequence:CCGGAGCATCCATCTTCTGACATACCTCGAGGTATGTCAGAAGATGGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018488.2-408s21c1
Sequence:CCGGTGCCGATGACCATCGCTACAACTCGAGTTGTAGCGATGGTCATCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018488.2-2252s1c1
Sequence:CCGGGCCACAATGTGTACTTTGATACTCGAGTATCAAAGTACACATTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018488.2-1450s1c1
Sequence:CCGGGCCCACTTTAGTGTCTACAATCTCGAGATTGTAGACACTAAAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018488.2-228s1c1
Sequence:CCGGGCAGACCATCGAGAACATCAACTCGAGTTGATGTTCTCGATGGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018488.2-1567s1c1
Sequence:CCGGCCACATCTAAATGCTGCCAATCTCGAGATTGGCAGCATTTAGATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018488.2-1620s1c1
Sequence:CCGGCCGAGAATCTTCCTTACAGTACTCGAGTACTGTAAGGAAGATTCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks