EMAIL THIS PAGE TO A FRIEND

TBX5

T-box 5

Synonyms: HOS
UniProtKB ID: Q99593, A6ND77, O15301, Q96TB0, Q9Y4I2
Gene ID:
Human(6910) Summary: This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is closely linked to related family member T-box 3 (ulnar mammary syndrome) on human chromosome 12. The encoded protein may play a role in heart development and specification of limb identity. Mutations in this gene have been associated with Holt-Oram syndrome, a developmental disorder affecting the heart and upper limbs. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(21388) T-box 5
Rat(304514) T-box 5
cow(532970) T-box 5
chicken(373988) T-box 5
dog(491447) T-box 5
190 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000192 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000192 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000192 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011537 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011537 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011537 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000192 Rosetta Predictions human pricing
NM_080717 Rosetta Predictions human pricing
NM_080718 Rosetta Predictions human pricing
NM_181486 Rosetta Predictions human pricing
NM_001009964 Rosetta Predictions rat pricing
XM_579320 Rosetta Predictions rat pricing
NM_011537 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193647 predicted 1217
2 SASI_Hs01_00193648 predicted 1258
3 SASI_Hs01_00193649 predicted 1195
4 SASI_Hs01_00193651 predicted 1014
5 SASI_Hs01_00193652 predicted 1329
6 SASI_Hs01_00193653 predicted 1205
7 SASI_Hs01_00193654 predicted 1293
8 SASI_Hs01_00193655 predicted 1256
9 SASI_Hs01_00193656 predicted 1271
10 SASI_Hs02_00302044 predicted 1378
11 SASI_Hs01_00193650 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200066 predicted 1025
2 SASI_Hs01_00200067 predicted 1072
3 SASI_Hs01_00200068 predicted 1008
4 SASI_Hs01_00200070 predicted 831
5 SASI_Hs01_00200071 predicted 1147
6 SASI_Hs01_00200072 predicted 1016
7 SASI_Hs01_00200073 predicted 1108
8 SASI_Hs01_00200074 predicted 1074
9 SASI_Hs01_00200075 predicted 1088
10 SASI_Hs02_00362493 predicted 1193
11 SASI_Hs01_00200069 predicted 1120
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089269 predicted 547
2 SASI_Hs01_00089270 predicted 592
3 SASI_Hs01_00089271 predicted 528
4 SASI_Hs01_00089273 predicted 346
5 SASI_Hs01_00089274 predicted 666
6 SASI_Hs01_00089275 predicted 537
7 SASI_Hs01_00089276 predicted 626
8 SASI_Hs01_00089277 predicted 592
9 SASI_Hs01_00089278 predicted 606
10 SASI_Hs02_00362494 predicted 703
11 SASI_Hs01_00089272 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145603 predicted 1039
2 SASI_Hs01_00145604 predicted 1089
3 SASI_Hs01_00145605 predicted 1017
4 SASI_Hs01_00145607 predicted 844
5 SASI_Hs01_00145608 predicted 1160
6 SASI_Hs01_00145609 predicted 1033
7 SASI_Hs01_00145610 predicted 1117
8 SASI_Hs01_00145611 predicted 1086
9 SASI_Hs01_00145612 predicted 1106
10 SASI_Hs02_00370104 predicted 1201
11 SASI_Hs01_00145606 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043347 predicted 396
2 SASI_Rn01_00043348 predicted 412
3 SASI_Rn01_00043349 predicted 1195
4 SASI_Rn01_00043350 predicted 310
5 SASI_Rn01_00043351 predicted 661
6 SASI_Rn01_00043352 predicted 369
7 SASI_Rn01_00043353 predicted 962
8 SASI_Rn02_00199797 predicted 371
9 SASI_Rn01_00043354 predicted 262
10 SASI_Rn02_00199798 predicted 310
11 SASI_Rn01_00043355 predicted 297
12 SASI_Rn01_00043356 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579320 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00183819 predicted 401
2 SASI_Rn01_00183820 predicted 419
3 SASI_Rn01_00183821 predicted 1198
4 SASI_Rn01_00183822 predicted 315
5 SASI_Rn01_00183823 predicted 666
6 SASI_Rn01_00183824 predicted 373
7 SASI_Rn01_00183825 predicted 973
8 SASI_Rn01_00183826 predicted 293
9 SASI_Rn01_00183827 predicted 526
10 SASI_Rn01_00183828 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011537 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069158 predicted 941
2 SASI_Mm01_00069159 predicted 1832
3 SASI_Mm01_00069160 predicted 813
4 SASI_Mm01_00069161 predicted 1368
5 SASI_Mm01_00069162 predicted 654
6 SASI_Mm01_00069163 predicted 1048
7 SASI_Mm02_00320866 predicted 989
8 SASI_Mm01_00069165 predicted 889
9 SASI_Mm01_00069167 predicted 1705
10 SASI_Mm02_00320867 predicted 1603
11 SASI_Mm01_00069164 predicted 1302
12 SASI_Mm01_00069166 predicted 955
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000192
TBX5 MISSION shRNA Bacterial Glycerol Stock
T-box 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005071    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000192.3-3712s1c1
Sequence:CCGGCCTATGCGATTATGTCTCTTTCTCGAGAAAGAGACATAATCGCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000192.3-1638s1c1
Sequence:CCGGCCAAGAGGAAAGAGGAAGAATCTCGAGATTCTTCCTCTTTCCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000192.3-992s1c1
Sequence:CCGGGCCGACGATCACAGATACAAACTCGAGTTTGTATCTGTGATCGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000192.3-1396s1c1
Sequence:CCGGGCTGCACAGAATGTCAAGAATCTCGAGATTCTTGACATTCTGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000192.3-1208s1c1
Sequence:CCGGCCTAGATTACACATCGTGAAACTCGAGTTTCACGATGTGTAATCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000192
TBX5 MISSION shRNA shRNA Plasmid DNA
T-box 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005071    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000192.3-3712s1c1
Sequence:CCGGCCTATGCGATTATGTCTCTTTCTCGAGAAAGAGACATAATCGCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000192.3-1638s1c1
Sequence:CCGGCCAAGAGGAAAGAGGAAGAATCTCGAGATTCTTCCTCTTTCCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000192.3-992s1c1
Sequence:CCGGGCCGACGATCACAGATACAAACTCGAGTTTGTATCTGTGATCGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000192.3-1396s1c1
Sequence:CCGGGCTGCACAGAATGTCAAGAATCTCGAGATTCTTGACATTCTGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000192.3-1208s1c1
Sequence:CCGGCCTAGATTACACATCGTGAAACTCGAGTTTCACGATGTGTAATCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000192
TBX5 MISSION shRNA Lentiviral Transduction Particles
T-box 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005071    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000192.3-3712s1c1
Sequence:CCGGCCTATGCGATTATGTCTCTTTCTCGAGAAAGAGACATAATCGCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000192.3-1638s1c1
Sequence:CCGGCCAAGAGGAAAGAGGAAGAATCTCGAGATTCTTCCTCTTTCCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000192.3-992s1c1
Sequence:CCGGGCCGACGATCACAGATACAAACTCGAGTTTGTATCTGTGATCGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000192.3-1396s1c1
Sequence:CCGGGCTGCACAGAATGTCAAGAATCTCGAGATTCTTGACATTCTGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000192.3-1208s1c1
Sequence:CCGGCCTAGATTACACATCGTGAAACTCGAGTTTCACGATGTGTAATCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011537
TBX5 MISSION shRNA Bacterial Glycerol Stock
T-box 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011537.1-1000s1c1
Sequence:CCGGCGGTTCAAAGAACACTGCGTTCTCGAGAACGCAGTGTTCTTTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011537.1-1501s1c1
Sequence:CCGGGCAGGGCCTGAGTACCTCTTACTCGAGTAAGAGGTACTCAGGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011537.1-1358s1c1
Sequence:CCGGGCCCAGGAGCACAGCCAAATTCTCGAGAATTTGGCTGTGCTCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011537.1-767s1c1
Sequence:CCGGGCTGATAACAAATGGTCCGTACTCGAGTACGGACCATTTGTTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011537.1-667s1c1
Sequence:CCGGGTTTCCTAGTTACAAAGTGAACTCGAGTTCACTTTGTAACTAGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011537.3-1195s21c1
Sequence:CCGGCCCGATTACACATCGTGAAAGCTCGAGCTTTCACGATGTGTAATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011537.3-1922s21c1
Sequence:CCGGCCAGCACTTCTCCGCTCATTTCTCGAGAAATGAGCGGAGAAGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011537.3-952s21c1
Sequence:CCGGATATTCTTCTCATGGATATTGCTCGAGCAATATCCATGAGAAGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011537.3-977s21c1
Sequence:CCGGCGCAGACGACCACAGATATAACTCGAGTTATATCTGTGGTCGTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011537
TBX5 MISSION shRNA shRNA Plasmid DNA
T-box 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011537.1-1000s1c1
Sequence:CCGGCGGTTCAAAGAACACTGCGTTCTCGAGAACGCAGTGTTCTTTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011537.1-1501s1c1
Sequence:CCGGGCAGGGCCTGAGTACCTCTTACTCGAGTAAGAGGTACTCAGGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011537.1-1358s1c1
Sequence:CCGGGCCCAGGAGCACAGCCAAATTCTCGAGAATTTGGCTGTGCTCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011537.1-767s1c1
Sequence:CCGGGCTGATAACAAATGGTCCGTACTCGAGTACGGACCATTTGTTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011537.1-667s1c1
Sequence:CCGGGTTTCCTAGTTACAAAGTGAACTCGAGTTCACTTTGTAACTAGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011537.3-1195s21c1
Sequence:CCGGCCCGATTACACATCGTGAAAGCTCGAGCTTTCACGATGTGTAATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011537.3-1922s21c1
Sequence:CCGGCCAGCACTTCTCCGCTCATTTCTCGAGAAATGAGCGGAGAAGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011537.3-952s21c1
Sequence:CCGGATATTCTTCTCATGGATATTGCTCGAGCAATATCCATGAGAAGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011537.3-977s21c1
Sequence:CCGGCGCAGACGACCACAGATATAACTCGAGTTATATCTGTGGTCGTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011537
TBX5 MISSION shRNA Lentiviral Transduction Particles
T-box 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011537.1-1000s1c1
Sequence:CCGGCGGTTCAAAGAACACTGCGTTCTCGAGAACGCAGTGTTCTTTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011537.1-1501s1c1
Sequence:CCGGGCAGGGCCTGAGTACCTCTTACTCGAGTAAGAGGTACTCAGGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011537.1-1358s1c1
Sequence:CCGGGCCCAGGAGCACAGCCAAATTCTCGAGAATTTGGCTGTGCTCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011537.1-767s1c1
Sequence:CCGGGCTGATAACAAATGGTCCGTACTCGAGTACGGACCATTTGTTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011537.1-667s1c1
Sequence:CCGGGTTTCCTAGTTACAAAGTGAACTCGAGTTCACTTTGTAACTAGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011537.3-1195s21c1
Sequence:CCGGCCCGATTACACATCGTGAAAGCTCGAGCTTTCACGATGTGTAATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011537.3-1922s21c1
Sequence:CCGGCCAGCACTTCTCCGCTCATTTCTCGAGAAATGAGCGGAGAAGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011537.3-952s21c1
Sequence:CCGGATATTCTTCTCATGGATATTGCTCGAGCAATATCCATGAGAAGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011537.3-977s21c1
Sequence:CCGGCGCAGACGACCACAGATATAACTCGAGTTATATCTGTGGTCGTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks