EMAIL THIS PAGE TO A FRIEND

TBX6

T-box 6

UniProtKB ID: O95947, Q8TAS4
Gene ID:
Human(6911) Summary: This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. Knockout studies in mice indicate that this gene is important for specification of paraxial mesoderm structures. [provided by RefSeq, Aug 2008]
Mouse(21389) T-box 6
Rat(365371) T-box 6
Zebrafish(30254) T-box gene 6
dog(489948) T-box 6
chicken(395792) T-box 6
cow(526448) T-box 6
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004608 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004608 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004608 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011538 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011538 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011538 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004608 Rosetta Predictions human pricing
NM_080758 Rosetta Predictions human pricing
NM_001108920 Rosetta Predictions rat pricing
NM_011538 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166068 predicted 993
2 SASI_Hs01_00166070 predicted 1263
3 SASI_Hs01_00166071 predicted 998
4 SASI_Hs01_00166072 predicted 980
5 SASI_Hs01_00166073 predicted 1049
6 SASI_Hs01_00166074 predicted 974
7 SASI_Hs01_00166075 predicted 1008
8 SASI_Hs01_00166077 predicted 1058
9 SASI_Hs02_00337987 predicted 984
10 SASI_Hs02_00337988 predicted 1030
11 SASI_Hs01_00166069 predicted 1103
12 SASI_Hs01_00166076 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020830 predicted 996
2 SASI_Hs01_00020832 predicted 1257
3 SASI_Hs01_00020833 predicted 1005
4 SASI_Hs01_00020834 predicted 981
5 SASI_Hs01_00020835 predicted 1042
6 SASI_Hs01_00020836 predicted 974
7 SASI_Hs01_00020837 predicted 1006
8 SASI_Hs01_00020839 predicted 1061
9 SASI_Hs02_00362552 predicted 985
10 SASI_Hs02_00362553 predicted 1028
11 SASI_Hs01_00020831 predicted 1105
12 SASI_Hs01_00020838 predicted 1224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243394 predicted 733
2 SASI_Rn02_00243395 predicted 583
3 SASI_Rn02_00243396 predicted 425
4 SASI_Rn02_00243397 predicted 690
5 SASI_Rn02_00243398 predicted 782
6 SASI_Rn02_00243399 predicted 640
7 SASI_Rn02_00243400 predicted 1166
8 SASI_Rn02_00243401 predicted 327
9 SASI_Rn02_00243402 predicted 358
10 SASI_Rn02_00243403 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011538 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102124 predicted 737
2 SASI_Mm01_00102125 predicted 428
3 SASI_Mm01_00102126 predicted 378
4 SASI_Mm01_00102128 predicted 1062
5 SASI_Mm01_00102129 predicted 1118
6 SASI_Mm01_00102130 predicted 783
7 SASI_Mm01_00102131 predicted 692
8 SASI_Mm01_00102132 predicted 642
9 SASI_Mm02_00320868 predicted 1169
10 SASI_Mm01_00102133 predicted 685
11 SASI_Mm01_00102127 predicted 587
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004608
TBX6 MISSION shRNA Bacterial Glycerol Stock
T-box 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004608.3-473s21c1
Sequence:CCGGTGTTTCTTCTGGATGTGATTCCTCGAGGAATCACATCCAGAAGAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004608.3-1537s21c1
Sequence:CCGGTGGCTTCAAAGCCTAACCAAGCTCGAGCTTGGTTAGGCTTTGAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004608.3-1340s21c1
Sequence:CCGGATCTGGATGTGGGCTCCAAACCTCGAGGTTTGGAGCCCACATCCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004608.2-2133s1c1
Sequence:CCGGCCTCAACTTCACACCTTGATTCTCGAGAATCAAGGTGTGAAGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004608.2-1451s1c1
Sequence:CCGGCAGAACCCACAGATCACACAACTCGAGTTGTGTGATCTGTGGGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004608.2-1648s1c1
Sequence:CCGGCATTCGTGAATCAGATCCAGACTCGAGTCTGGATCTGATTCACGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004608.2-1270s1c1
Sequence:CCGGCCATCGTGTCAAGCTCACCAACTCGAGTTGGTGAGCTTGACACGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004608.2-1469s1c1
Sequence:CCGGCAACTGAAGATTGCAGCCAATCTCGAGATTGGCTGCAATCTTCAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004608
TBX6 MISSION shRNA shRNA Plasmid DNA
T-box 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004608.3-473s21c1
Sequence:CCGGTGTTTCTTCTGGATGTGATTCCTCGAGGAATCACATCCAGAAGAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004608.3-1537s21c1
Sequence:CCGGTGGCTTCAAAGCCTAACCAAGCTCGAGCTTGGTTAGGCTTTGAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004608.3-1340s21c1
Sequence:CCGGATCTGGATGTGGGCTCCAAACCTCGAGGTTTGGAGCCCACATCCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004608.2-2133s1c1
Sequence:CCGGCCTCAACTTCACACCTTGATTCTCGAGAATCAAGGTGTGAAGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004608.2-1451s1c1
Sequence:CCGGCAGAACCCACAGATCACACAACTCGAGTTGTGTGATCTGTGGGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004608.2-1648s1c1
Sequence:CCGGCATTCGTGAATCAGATCCAGACTCGAGTCTGGATCTGATTCACGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004608.2-1270s1c1
Sequence:CCGGCCATCGTGTCAAGCTCACCAACTCGAGTTGGTGAGCTTGACACGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004608.2-1469s1c1
Sequence:CCGGCAACTGAAGATTGCAGCCAATCTCGAGATTGGCTGCAATCTTCAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004608
TBX6 MISSION shRNA Lentiviral Transduction Particles
T-box 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004608.3-473s21c1
Sequence:CCGGTGTTTCTTCTGGATGTGATTCCTCGAGGAATCACATCCAGAAGAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004608.3-1537s21c1
Sequence:CCGGTGGCTTCAAAGCCTAACCAAGCTCGAGCTTGGTTAGGCTTTGAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004608.3-1340s21c1
Sequence:CCGGATCTGGATGTGGGCTCCAAACCTCGAGGTTTGGAGCCCACATCCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004608.2-2133s1c1
Sequence:CCGGCCTCAACTTCACACCTTGATTCTCGAGAATCAAGGTGTGAAGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004608.2-1451s1c1
Sequence:CCGGCAGAACCCACAGATCACACAACTCGAGTTGTGTGATCTGTGGGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004608.2-1648s1c1
Sequence:CCGGCATTCGTGAATCAGATCCAGACTCGAGTCTGGATCTGATTCACGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004608.2-1270s1c1
Sequence:CCGGCCATCGTGTCAAGCTCACCAACTCGAGTTGGTGAGCTTGACACGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004608.2-1469s1c1
Sequence:CCGGCAACTGAAGATTGCAGCCAATCTCGAGATTGGCTGCAATCTTCAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011538
TBX6 MISSION shRNA Bacterial Glycerol Stock
T-box 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011538.2-742s21c1
Sequence:CCGGCGATTTCCTGAGACCACATTCCTCGAGGAATGTGGTCTCAGGAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011538.2-1559s21c1
Sequence:CCGGGCTCTCACCTTAGTGCGAATGCTCGAGCATTCGCACTAAGGTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011538.2-1331s21c1
Sequence:CCGGACTGAGCCTCGGTGTAGTAACCTCGAGGTTACTACACCGAGGCTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011538.1-1399s1c1
Sequence:CCGGGCATCCGCATTGAAGTGGTATCTCGAGATACCACTTCAATGCGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011538.1-315s1c1
Sequence:CCGGCCAGGAACTGTGGAAGGAATTCTCGAGAATTCCTTCCACAGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011538.1-600s1c1
Sequence:CCGGCCATCGTGTTAAGCTCACCAACTCGAGTTGGTGAGCTTAACACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011538.1-1459s1c1
Sequence:CCGGCCACCCTTTAGTTCACACCTTCTCGAGAAGGTGTGAACTAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011538.1-139s1c1
Sequence:CCGGCCTGATTTGGATACTTCTAAACTCGAGTTTAGAAGTATCCAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011538
TBX6 MISSION shRNA shRNA Plasmid DNA
T-box 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011538.2-742s21c1
Sequence:CCGGCGATTTCCTGAGACCACATTCCTCGAGGAATGTGGTCTCAGGAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011538.2-1559s21c1
Sequence:CCGGGCTCTCACCTTAGTGCGAATGCTCGAGCATTCGCACTAAGGTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011538.2-1331s21c1
Sequence:CCGGACTGAGCCTCGGTGTAGTAACCTCGAGGTTACTACACCGAGGCTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011538.1-1399s1c1
Sequence:CCGGGCATCCGCATTGAAGTGGTATCTCGAGATACCACTTCAATGCGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011538.1-315s1c1
Sequence:CCGGCCAGGAACTGTGGAAGGAATTCTCGAGAATTCCTTCCACAGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011538.1-600s1c1
Sequence:CCGGCCATCGTGTTAAGCTCACCAACTCGAGTTGGTGAGCTTAACACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011538.1-1459s1c1
Sequence:CCGGCCACCCTTTAGTTCACACCTTCTCGAGAAGGTGTGAACTAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011538.1-139s1c1
Sequence:CCGGCCTGATTTGGATACTTCTAAACTCGAGTTTAGAAGTATCCAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011538
TBX6 MISSION shRNA Lentiviral Transduction Particles
T-box 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011538.2-742s21c1
Sequence:CCGGCGATTTCCTGAGACCACATTCCTCGAGGAATGTGGTCTCAGGAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011538.2-1559s21c1
Sequence:CCGGGCTCTCACCTTAGTGCGAATGCTCGAGCATTCGCACTAAGGTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011538.2-1331s21c1
Sequence:CCGGACTGAGCCTCGGTGTAGTAACCTCGAGGTTACTACACCGAGGCTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011538.1-1399s1c1
Sequence:CCGGGCATCCGCATTGAAGTGGTATCTCGAGATACCACTTCAATGCGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011538.1-315s1c1
Sequence:CCGGCCAGGAACTGTGGAAGGAATTCTCGAGAATTCCTTCCACAGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011538.1-600s1c1
Sequence:CCGGCCATCGTGTTAAGCTCACCAACTCGAGTTGGTGAGCTTAACACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011538.1-1459s1c1
Sequence:CCGGCCACCCTTTAGTTCACACCTTCTCGAGAAGGTGTGAACTAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011538.1-139s1c1
Sequence:CCGGCCTGATTTGGATACTTCTAAACTCGAGTTTAGAAGTATCCAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks