EMAIL THIS PAGE TO A FRIEND

TBXA2R

thromboxane A2 receptor

Synonyms: BDPLT13 TXA2-R
UniProtKB ID: P21731, O75228, Q6DK52, Q9UCY1, Q9UCY2
Gene ID:
Human(6915) Summary: This gene encodes a member of the G protein-coupled receptor family. The protein interacts with thromboxane A2 to induce platelet aggregation and regulate hemostasis. A mutation in this gene results in a bleeding disorder. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(21390) thromboxane A2 receptor
Rat(24816) thromboxane A2 receptor
chicken(100857635) thromboxane A2 receptor
domestic cat(101089081) thromboxane A2 receptor
dog(485056) thromboxane A2 receptor
domestic guinea pig(100717592) thromboxane A2 receptor
naked mole-rat(101698956) thromboxane A2 receptor
Domestic Rabbit(100008908) thromboxane A2 receptor
cow(538783) thromboxane A2 receptor
sheep(101116048) thromboxane A2 receptor
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009325 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009325 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009325 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001060 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001060 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001060 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140211 MISSION® esiRNA esiRNA human TBXA2R (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001060 Rosetta Predictions human pricing
NM_201636 Rosetta Predictions human pricing
NM_017054 Rosetta Predictions rat pricing
NM_009325 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153911 predicted 235
2 SASI_Hs01_00153912 predicted 723
3 SASI_Hs01_00153913 predicted 235
4 SASI_Hs01_00153914 predicted 240
5 SASI_Hs01_00153915 predicted 520
6 SASI_Hs01_00153916 predicted 592
7 SASI_Hs01_00153917 predicted 521
8 SASI_Hs01_00153918 predicted 455
9 SASI_Hs01_00153919 predicted 241
10 SASI_Hs01_00153920 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139383 predicted 240
2 SASI_Hs01_00139384 predicted 728
3 SASI_Hs01_00139385 predicted 234
4 SASI_Hs01_00139386 predicted 234
5 SASI_Hs01_00139387 predicted 522
6 SASI_Hs01_00139388 predicted 591
7 SASI_Hs01_00139389 predicted 523
8 SASI_Hs01_00139390 predicted 458
9 SASI_Hs01_00139391 predicted 236
10 SASI_Hs01_00139392 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017054 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089343 predicted 1517
2 SASI_Rn02_00261244 predicted 1484
3 SASI_Rn01_00089344 predicted 420
4 SASI_Rn02_00261245 predicted 408
5 SASI_Rn01_00089345 predicted 1504
6 SASI_Rn01_00089346 predicted 1169
7 SASI_Rn01_00089347 predicted 1405
8 SASI_Rn01_00089348 predicted 1382
9 SASI_Rn02_00261246 predicted 1510
10 SASI_Rn01_00089351 predicted 1407
11 SASI_Rn01_00089342 predicted 1605
12 SASI_Rn01_00089349 predicted 1629
13 SASI_Rn01_00089350 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009325 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192172 predicted 1065
2 SASI_Mm01_00192173 predicted 467
3 SASI_Mm01_00192174 predicted 627
4 SASI_Mm01_00192175 predicted 1564
5 SASI_Mm01_00192176 predicted 1557
6 SASI_Mm02_00315883 predicted 1451
7 SASI_Mm01_00192179 predicted 1087
8 SASI_Mm01_00192180 predicted 1675
9 SASI_Mm01_00192181 predicted 1083
10 SASI_Mm02_00315884 predicted 507
11 SASI_Mm01_00192177 predicted 1457
12 SASI_Mm01_00192178 predicted 1520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009325
TBXA2R MISSION shRNA Bacterial Glycerol Stock
thromboxane A2 receptor
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009325.1-961s1c1
Sequence:CCGGCTTCATCATGCAGACTTTGTTCTCGAGAACAAAGTCTGCATGATGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009325.1-1085s1c1
Sequence:CCGGCCCTGGGTCTATATCCTCTTTCTCGAGAAAGAGGATATAGACCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009325.1-382s1c1
Sequence:CCGGCGGCCTTGTTCTCACCGACTTCTCGAGAAGTCGGTGAGAACAAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009325.1-754s1c1
Sequence:CCGGCGTGGTCTTCGGGCTCATATTCTCGAGAATATGAGCCCGAAGACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009325.1-220s1c1
Sequence:CCGGCCCGGTGAACATCACGCTGCACTCGAGTGCAGCGTGATGTTCACCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009325.3-751s21c1
Sequence:CCGGGGGTAGCTATGGTGTTCTTCGCTCGAGCGAAGAACACCATAGCTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000453158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009325.3-1537s21c1
Sequence:CCGGCTAAGGACGGAGCTACGACATCTCGAGATGTCGTAGCTCCGTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009325
TBXA2R MISSION shRNA shRNA Plasmid DNA
thromboxane A2 receptor
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009325.1-961s1c1
Sequence:CCGGCTTCATCATGCAGACTTTGTTCTCGAGAACAAAGTCTGCATGATGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009325.1-1085s1c1
Sequence:CCGGCCCTGGGTCTATATCCTCTTTCTCGAGAAAGAGGATATAGACCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009325.1-382s1c1
Sequence:CCGGCGGCCTTGTTCTCACCGACTTCTCGAGAAGTCGGTGAGAACAAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009325.1-754s1c1
Sequence:CCGGCGTGGTCTTCGGGCTCATATTCTCGAGAATATGAGCCCGAAGACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009325.1-220s1c1
Sequence:CCGGCCCGGTGAACATCACGCTGCACTCGAGTGCAGCGTGATGTTCACCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009325.3-751s21c1
Sequence:CCGGGGGTAGCTATGGTGTTCTTCGCTCGAGCGAAGAACACCATAGCTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000453158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009325.3-1537s21c1
Sequence:CCGGCTAAGGACGGAGCTACGACATCTCGAGATGTCGTAGCTCCGTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009325
TBXA2R MISSION shRNA Lentiviral Transduction Particles
thromboxane A2 receptor
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009325.1-961s1c1
Sequence:CCGGCTTCATCATGCAGACTTTGTTCTCGAGAACAAAGTCTGCATGATGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009325.1-1085s1c1
Sequence:CCGGCCCTGGGTCTATATCCTCTTTCTCGAGAAAGAGGATATAGACCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009325.1-382s1c1
Sequence:CCGGCGGCCTTGTTCTCACCGACTTCTCGAGAAGTCGGTGAGAACAAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009325.1-754s1c1
Sequence:CCGGCGTGGTCTTCGGGCTCATATTCTCGAGAATATGAGCCCGAAGACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009325.1-220s1c1
Sequence:CCGGCCCGGTGAACATCACGCTGCACTCGAGTGCAGCGTGATGTTCACCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009325.3-751s21c1
Sequence:CCGGGGGTAGCTATGGTGTTCTTCGCTCGAGCGAAGAACACCATAGCTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000453158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009325.3-1537s21c1
Sequence:CCGGCTAAGGACGGAGCTACGACATCTCGAGATGTCGTAGCTCCGTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001060
TBXA2R MISSION shRNA Bacterial Glycerol Stock
thromboxane A2 receptor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001060.3-253s1c1
Sequence:CCGGGCCCACAAACATTACCCTGGACTCGAGTCCAGGGTAATGTTTGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001060.3-517s1c1
Sequence:CCGGCTGCCGTCTCTGTCGCTTCATCTCGAGATGAAGCGACAGAGACGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001060.3-1009s1c1
Sequence:CCGGCGCCCAGACAGTGCTGCGAAACTCGAGTTTCGCAGCACTGTCTGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001060.3-1264s1c1
Sequence:CCGGCCTCCCGCGCCTTTCCGCGGACTCGAGTCCGCGGAAAGGCGCGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001060.3-1081s1c1
Sequence:CCGGGCTGCTCATCTACTTGCGCGTCTCGAGACGCGCAAGTAGATGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001060.4-536s21c1
Sequence:CCGGATGGGCGTCGTCATGATCTTCCTCGAGGAAGATCATGACGACGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001060.4-727s21c1
Sequence:CCGGGGGTCGCTACACCGTGCAATACTCGAGTATTGCACGGTGTAGCGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001060.4-1528s21c1
Sequence:CCGGGAGGGTCTTGCATTGCTATTTCTCGAGAAATAGCAATGCAAGACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001060.4-1310s21c1
Sequence:CCGGCTGCCTGTTCTGAGGATTCAGCTCGAGCTGAATCCTCAGAACAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001060.4-1074s21c1
Sequence:CCGGAGAAGGAGCTGCTCATCTACTCTCGAGAGTAGATGAGCAGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001060
TBXA2R MISSION shRNA shRNA Plasmid DNA
thromboxane A2 receptor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001060.3-253s1c1
Sequence:CCGGGCCCACAAACATTACCCTGGACTCGAGTCCAGGGTAATGTTTGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001060.3-517s1c1
Sequence:CCGGCTGCCGTCTCTGTCGCTTCATCTCGAGATGAAGCGACAGAGACGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001060.3-1009s1c1
Sequence:CCGGCGCCCAGACAGTGCTGCGAAACTCGAGTTTCGCAGCACTGTCTGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001060.3-1264s1c1
Sequence:CCGGCCTCCCGCGCCTTTCCGCGGACTCGAGTCCGCGGAAAGGCGCGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001060.3-1081s1c1
Sequence:CCGGGCTGCTCATCTACTTGCGCGTCTCGAGACGCGCAAGTAGATGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001060.4-536s21c1
Sequence:CCGGATGGGCGTCGTCATGATCTTCCTCGAGGAAGATCATGACGACGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001060.4-727s21c1
Sequence:CCGGGGGTCGCTACACCGTGCAATACTCGAGTATTGCACGGTGTAGCGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001060.4-1528s21c1
Sequence:CCGGGAGGGTCTTGCATTGCTATTTCTCGAGAAATAGCAATGCAAGACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001060.4-1310s21c1
Sequence:CCGGCTGCCTGTTCTGAGGATTCAGCTCGAGCTGAATCCTCAGAACAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001060.4-1074s21c1
Sequence:CCGGAGAAGGAGCTGCTCATCTACTCTCGAGAGTAGATGAGCAGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001060
TBXA2R MISSION shRNA Lentiviral Transduction Particles
thromboxane A2 receptor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001060.3-253s1c1
Sequence:CCGGGCCCACAAACATTACCCTGGACTCGAGTCCAGGGTAATGTTTGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001060.3-517s1c1
Sequence:CCGGCTGCCGTCTCTGTCGCTTCATCTCGAGATGAAGCGACAGAGACGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001060.3-1009s1c1
Sequence:CCGGCGCCCAGACAGTGCTGCGAAACTCGAGTTTCGCAGCACTGTCTGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001060.3-1264s1c1
Sequence:CCGGCCTCCCGCGCCTTTCCGCGGACTCGAGTCCGCGGAAAGGCGCGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001060.3-1081s1c1
Sequence:CCGGGCTGCTCATCTACTTGCGCGTCTCGAGACGCGCAAGTAGATGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001060.4-536s21c1
Sequence:CCGGATGGGCGTCGTCATGATCTTCCTCGAGGAAGATCATGACGACGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001060.4-727s21c1
Sequence:CCGGGGGTCGCTACACCGTGCAATACTCGAGTATTGCACGGTGTAGCGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001060.4-1528s21c1
Sequence:CCGGGAGGGTCTTGCATTGCTATTTCTCGAGAAATAGCAATGCAAGACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001060.4-1310s21c1
Sequence:CCGGCTGCCTGTTCTGAGGATTCAGCTCGAGCTGAATCCTCAGAACAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001060.4-1074s21c1
Sequence:CCGGAGAAGGAGCTGCTCATCTACTCTCGAGAGTAGATGAGCAGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks