EMAIL THIS PAGE TO A FRIEND

TBXAS1

thromboxane A synthase 1 (platelet)

Synonyms: BDPLT14 CYP5 CYP5A1 GHOSAL THAS TS TXAS TXS
Gene ID:
Human(6916) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. However, this protein is considered a member of the cytochrome P450 superfamily on the basis of sequence similarity rather than functional similarity. This endoplasmic reticulum membrane protein catalyzes the conversion of prostglandin H2 to thromboxane A2, a potent vasoconstrictor and inducer of platelet aggregation. The enzyme plays a role in several pathophysiological processes including hemostasis, cardiovascular disease, and stroke. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(21391) thromboxane A synthase 1, platelet
Rat(24886) thromboxane A synthase 1, platelet
cow(509326) thromboxane A synthase 1 (platelet)
sheep(101111361) thromboxane A synthase 1 (platelet)
Domestic Rabbit(100339354) thromboxane A synthase 1 (platelet)
naked mole-rat(101697368) thromboxane A synthase 1 (platelet)
domestic guinea pig(100719442) thromboxane A synthase 1 (platelet)
Zebrafish(792041) thromboxane A synthase 1 (platelet, cytochrome P450, family 5, subfamily A)
chicken(418101) thromboxane A synthase 1 (platelet)
domestic cat(101091097) thromboxane A synthase 1 (platelet)
Horse(100066198) thromboxane A synthase 1 (platelet)
dog(482771) thromboxane A synthase 1 (platelet)
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
N7634 Nifedipine ≥98% (HPLC), powder human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001061 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001061 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001061 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011539 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011539 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011539 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060341 MISSION® esiRNA esiRNA human TBXAS1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001061 Rosetta Predictions human pricing
NM_030984 Rosetta Predictions human pricing
NM_012687 Rosetta Predictions rat pricing
NM_011539 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015066 predicted 961
2 SASI_Hs01_00015067 predicted 860
3 SASI_Hs01_00015068 predicted 1057
4 SASI_Hs01_00015069 predicted 913
5 SASI_Hs01_00015070 predicted 354
6 SASI_Hs01_00015071 predicted 513
7 SASI_Hs01_00015072 predicted 536
8 SASI_Hs01_00015073 predicted 434
9 SASI_Hs01_00015074 predicted 547
10 SASI_Hs01_00015075 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030984 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107042 predicted 963
2 SASI_Hs01_00107043 predicted 858
3 SASI_Hs01_00107044 predicted 1062
4 SASI_Hs01_00107045 predicted 922
5 SASI_Hs01_00107046 predicted 353
6 SASI_Hs01_00107047 predicted 507
7 SASI_Hs01_00107048 predicted 532
8 SASI_Hs01_00107049 predicted 432
9 SASI_Hs01_00107050 predicted 547
10 SASI_Hs01_00107051 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012687 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031945 predicted 1090
2 SASI_Rn01_00031946 predicted 856
3 SASI_Rn02_00259987 predicted 599
4 SASI_Rn01_00031947 predicted 826
5 SASI_Rn01_00031948 predicted 893
6 SASI_Rn01_00031949 predicted 1473
7 SASI_Rn01_00031951 predicted 859
8 SASI_Rn01_00031952 predicted 1417
9 SASI_Rn02_00259988 predicted 221
10 SASI_Rn01_00031953 predicted 905
11 SASI_Rn01_00031944 predicted 600
12 SASI_Rn01_00031950 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011539 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156476 predicted 632
2 SASI_Mm01_00156477 predicted 842
3 SASI_Mm01_00156478 predicted 773
4 SASI_Mm01_00156479 predicted 1751
5 SASI_Mm02_00320869 predicted 1513
6 SASI_Mm01_00156480 predicted 863
7 SASI_Mm01_00156481 predicted 710
8 SASI_Mm01_00156483 predicted 1692
9 SASI_Mm01_00156484 predicted 1733
10 SASI_Mm01_00156485 predicted 259
11 SASI_Mm01_00156482 predicted 443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001061
TBXAS1 MISSION shRNA Bacterial Glycerol Stock
thromboxane A synthase 1 (platelet)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001061.4-489s21c1
Sequence:CCGGGTCGGATGTTTATTGTTATTTCTCGAGAAATAACAATAAACATCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001061.4-1252s21c1
Sequence:CCGGCCTCATCGCTGGCTATGAAATCTCGAGATTTCATAGCCAGCGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001061.4-926s21c1
Sequence:CCGGTTATCATTTCCATCCATAATGCTCGAGCATTATGGATGGAAATGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001061.2-968s1c1
Sequence:CCGGCCCAATAAGAACCGAGACGAACTCGAGTTCGTCTCGGTTCTTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001061.2-1770s1c1
Sequence:CCGGCGCTGCAGCTAGAATCCAAATCTCGAGATTTGGATTCTAGCTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001061.2-980s1c1
Sequence:CCGGCGAGACGAACTGAATGGCTTTCTCGAGAAAGCCATTCAGTTCGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001061.2-539s1c1
Sequence:CCGGGTTGAGAACTTCAGTAACTTTCTCGAGAAAGTTACTGAAGTTCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001061.2-772s1c1
Sequence:CCGGCCAGAGGTGCTACTGCAATTACTCGAGTAATTGCAGTAGCACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001061
TBXAS1 MISSION shRNA shRNA Plasmid DNA
thromboxane A synthase 1 (platelet)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001061.4-489s21c1
Sequence:CCGGGTCGGATGTTTATTGTTATTTCTCGAGAAATAACAATAAACATCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001061.4-1252s21c1
Sequence:CCGGCCTCATCGCTGGCTATGAAATCTCGAGATTTCATAGCCAGCGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001061.4-926s21c1
Sequence:CCGGTTATCATTTCCATCCATAATGCTCGAGCATTATGGATGGAAATGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001061.2-968s1c1
Sequence:CCGGCCCAATAAGAACCGAGACGAACTCGAGTTCGTCTCGGTTCTTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001061.2-1770s1c1
Sequence:CCGGCGCTGCAGCTAGAATCCAAATCTCGAGATTTGGATTCTAGCTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001061.2-980s1c1
Sequence:CCGGCGAGACGAACTGAATGGCTTTCTCGAGAAAGCCATTCAGTTCGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001061.2-539s1c1
Sequence:CCGGGTTGAGAACTTCAGTAACTTTCTCGAGAAAGTTACTGAAGTTCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001061.2-772s1c1
Sequence:CCGGCCAGAGGTGCTACTGCAATTACTCGAGTAATTGCAGTAGCACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001061
TBXAS1 MISSION shRNA Lentiviral Transduction Particles
thromboxane A synthase 1 (platelet)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001061.4-489s21c1
Sequence:CCGGGTCGGATGTTTATTGTTATTTCTCGAGAAATAACAATAAACATCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001061.4-1252s21c1
Sequence:CCGGCCTCATCGCTGGCTATGAAATCTCGAGATTTCATAGCCAGCGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001061.4-926s21c1
Sequence:CCGGTTATCATTTCCATCCATAATGCTCGAGCATTATGGATGGAAATGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001061.2-968s1c1
Sequence:CCGGCCCAATAAGAACCGAGACGAACTCGAGTTCGTCTCGGTTCTTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001061.2-1770s1c1
Sequence:CCGGCGCTGCAGCTAGAATCCAAATCTCGAGATTTGGATTCTAGCTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001061.2-980s1c1
Sequence:CCGGCGAGACGAACTGAATGGCTTTCTCGAGAAAGCCATTCAGTTCGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001061.2-539s1c1
Sequence:CCGGGTTGAGAACTTCAGTAACTTTCTCGAGAAAGTTACTGAAGTTCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001061.2-772s1c1
Sequence:CCGGCCAGAGGTGCTACTGCAATTACTCGAGTAATTGCAGTAGCACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011539
TBXAS1 MISSION shRNA Bacterial Glycerol Stock
thromboxane A synthase 1 (platelet)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011539.2-1340s1c2
Sequence:CCGGCCGTATCTGGACATGGTGATTCTCGAGAATCACCATGTCCAGATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011539.2-1863s1c1
Sequence:CCGGCGTGTGGAGATGGAGAGTTTACTCGAGTAAACTCTCCATCTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011539.2-1658s1c1
Sequence:CCGGCTACACAAGTTCCGCTTTGAACTCGAGTTCAAAGCGGAACTTGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011539.2-703s1c1
Sequence:CCGGCCAGAGGTGTTACTGCTGTTACTCGAGTAACAGCAGTAACACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011539.2-1120s1c1
Sequence:CCGGCCATCCTACCTCCACATCTAACTCGAGTTAGATGTGGAGGTAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011539
TBXAS1 MISSION shRNA shRNA Plasmid DNA
thromboxane A synthase 1 (platelet)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011539.2-1340s1c2
Sequence:CCGGCCGTATCTGGACATGGTGATTCTCGAGAATCACCATGTCCAGATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011539.2-1863s1c1
Sequence:CCGGCGTGTGGAGATGGAGAGTTTACTCGAGTAAACTCTCCATCTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011539.2-1658s1c1
Sequence:CCGGCTACACAAGTTCCGCTTTGAACTCGAGTTCAAAGCGGAACTTGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011539.2-703s1c1
Sequence:CCGGCCAGAGGTGTTACTGCTGTTACTCGAGTAACAGCAGTAACACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011539.2-1120s1c1
Sequence:CCGGCCATCCTACCTCCACATCTAACTCGAGTTAGATGTGGAGGTAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011539
TBXAS1 MISSION shRNA Lentiviral Transduction Particles
thromboxane A synthase 1 (platelet)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011539.2-1340s1c2
Sequence:CCGGCCGTATCTGGACATGGTGATTCTCGAGAATCACCATGTCCAGATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011539.2-1863s1c1
Sequence:CCGGCGTGTGGAGATGGAGAGTTTACTCGAGTAAACTCTCCATCTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011539.2-1658s1c1
Sequence:CCGGCTACACAAGTTCCGCTTTGAACTCGAGTTCAAAGCGGAACTTGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011539.2-703s1c1
Sequence:CCGGCCAGAGGTGTTACTGCTGTTACTCGAGTAACAGCAGTAACACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011539.2-1120s1c1
Sequence:CCGGCCATCCTACCTCCACATCTAACTCGAGTTAGATGTGGAGGTAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks