EMAIL THIS PAGE TO A FRIEND

TC2N

tandem C2 domains, nuclear

Synonyms: C14orf47 C2CD1 MTAC2D1 Tac2-N
UniProtKB ID: Q8N9U0
Gene ID:
Mouse(74413) tandem C2 domains, nuclear
Rat(500707) tandem C2 domains, nuclear
chicken(423412) tandem C2 domains, nuclear
domestic cat(101086400) tandem C2 domains, nuclear
Horse(100053113) tandem C2 domains, nuclear
dog(490589) tandem C2 domains, nuclear
domestic guinea pig(100715754) tandem C2 domains, nuclear
naked mole-rat(101710124) tandem C2 domains, nuclear
Domestic Rabbit(100347600) tandem C2 domains, nuclear
cow(534419) tandem C2 domains, nuclear
sheep(101112679) tandem C2 domains, nuclear
174 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152332 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152332 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152332 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028924 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028924 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028924 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152332 Rosetta Predictions human pricing
NM_001025152 Rosetta Predictions rat pricing
NM_001082976 Rosetta Predictions mouse pricing
NM_028924 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112294 predicted 1074
2 SASI_Hs01_00112295 predicted 573
3 SASI_Hs01_00112296 predicted 612
4 SASI_Hs01_00112297 predicted 1681
5 SASI_Hs02_00365931 predicted 1110
6 SASI_Hs01_00112298 predicted 680
7 SASI_Hs01_00112301 predicted 1554
8 SASI_Hs01_00112302 predicted 1310
9 SASI_Hs01_00112303 predicted 539
10 SASI_Hs02_00365932 predicted 1484
11 SASI_Hs01_00112299 predicted 601
12 SASI_Hs01_00112300 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025152 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054411 predicted 1054
2 SASI_Rn01_00054412 predicted 1103
3 SASI_Rn01_00054413 predicted 408
4 SASI_Rn01_00054414 predicted 753
5 SASI_Rn01_00054415 predicted 1140
6 SASI_Rn01_00054416 predicted 660
7 SASI_Rn01_00054417 predicted 328
8 SASI_Rn01_00054418 predicted 1724
9 SASI_Rn01_00054419 predicted 739
10 SASI_Rn01_00054420 predicted 1379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082976 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299444 predicted 947
2 SASI_Mm02_00299445 predicted 608
3 SASI_Mm02_00299446 predicted 1359
4 SASI_Mm02_00299447 predicted 1579
5 SASI_Mm02_00299448 predicted 1637
6 SASI_Mm02_00299449 predicted 656
7 SASI_Mm02_00299450 predicted 1287
8 SASI_Mm02_00299451 predicted 599
9 SASI_Mm02_00299452 predicted 1052
10 SASI_Mm02_00299453 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028924 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036727 predicted 1322
2 SASI_Mm01_00036728 predicted 987
3 SASI_Mm01_00036729 predicted 1732
4 SASI_Mm01_00036730 predicted 1954
5 SASI_Mm01_00036731 predicted 2012
6 SASI_Mm01_00036732 predicted 1026
7 SASI_Mm01_00036733 predicted 1661
8 SASI_Mm01_00036736 predicted 964
9 SASI_Mm02_00334623 predicted 1430
10 SASI_Mm02_00334624 predicted 845
11 SASI_Mm01_00036734 predicted 2262
12 SASI_Mm01_00036735 predicted 1006
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152332
VALIDATED
TC2N MISSION shRNA Bacterial Glycerol Stock
tandem C2 domains, nuclear
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152332.2-845s1c1
Sequence:CCGGGCCTGGATACAATTACTCTATCTCGAGATAGAGTAATTGTATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152332.2-1035s1c1
Sequence:CCGGGCATTTCAAATCTTCAGCCAACTCGAGTTGGCTGAAGATTTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152332.2-375s1c1
Sequence:CCGGGCTTGGCTGTACTGAGGATTACTCGAGTAATCCTCAGTACAGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152332.2-444s1c1
Sequence:CCGGGCCCAAGTTTAAGTTATCTTACTCGAGTAAGATAACTTAAACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152332.2-665s1c1
Sequence:CCGGCGAGACTGTATGGATCGGTTTCTCGAGAAACCGATCCATACAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152332.4-2261s21c1
Sequence:CCGGATTTCAGTGCTAGGCATTATTCTCGAGAATAATGCCTAGCACTGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152332.4-1820s21c1
Sequence:CCGGGTTATCAGGTGGCACAAATTACTCGAGTAATTTGTGCCACCTGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152332.4-2129s21c1
Sequence:CCGGGAGAATATCAACCATAGATAGCTCGAGCTATCTATGGTTGATATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152332.4-584s21c1
Sequence:CCGGGATGGCAAAGAAGTACCATTTCTCGAGAAATGGTACTTCTTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152332
VALIDATED
TC2N MISSION shRNA shRNA Plasmid DNA
tandem C2 domains, nuclear
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152332.2-845s1c1
Sequence:CCGGGCCTGGATACAATTACTCTATCTCGAGATAGAGTAATTGTATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152332.2-1035s1c1
Sequence:CCGGGCATTTCAAATCTTCAGCCAACTCGAGTTGGCTGAAGATTTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152332.2-375s1c1
Sequence:CCGGGCTTGGCTGTACTGAGGATTACTCGAGTAATCCTCAGTACAGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152332.2-444s1c1
Sequence:CCGGGCCCAAGTTTAAGTTATCTTACTCGAGTAAGATAACTTAAACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152332.2-665s1c1
Sequence:CCGGCGAGACTGTATGGATCGGTTTCTCGAGAAACCGATCCATACAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152332.4-2261s21c1
Sequence:CCGGATTTCAGTGCTAGGCATTATTCTCGAGAATAATGCCTAGCACTGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152332.4-1820s21c1
Sequence:CCGGGTTATCAGGTGGCACAAATTACTCGAGTAATTTGTGCCACCTGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152332.4-2129s21c1
Sequence:CCGGGAGAATATCAACCATAGATAGCTCGAGCTATCTATGGTTGATATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152332.4-584s21c1
Sequence:CCGGGATGGCAAAGAAGTACCATTTCTCGAGAAATGGTACTTCTTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152332
VALIDATED
TC2N MISSION shRNA Lentiviral Transduction Particles
tandem C2 domains, nuclear
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152332.2-845s1c1
Sequence:CCGGGCCTGGATACAATTACTCTATCTCGAGATAGAGTAATTGTATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152332.2-1035s1c1
Sequence:CCGGGCATTTCAAATCTTCAGCCAACTCGAGTTGGCTGAAGATTTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152332.2-375s1c1
Sequence:CCGGGCTTGGCTGTACTGAGGATTACTCGAGTAATCCTCAGTACAGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152332.2-444s1c1
Sequence:CCGGGCCCAAGTTTAAGTTATCTTACTCGAGTAAGATAACTTAAACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152332.2-665s1c1
Sequence:CCGGCGAGACTGTATGGATCGGTTTCTCGAGAAACCGATCCATACAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152332.4-2261s21c1
Sequence:CCGGATTTCAGTGCTAGGCATTATTCTCGAGAATAATGCCTAGCACTGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152332.4-1820s21c1
Sequence:CCGGGTTATCAGGTGGCACAAATTACTCGAGTAATTTGTGCCACCTGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152332.4-2129s21c1
Sequence:CCGGGAGAATATCAACCATAGATAGCTCGAGCTATCTATGGTTGATATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152332.4-584s21c1
Sequence:CCGGGATGGCAAAGAAGTACCATTTCTCGAGAAATGGTACTTCTTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028924
TC2N MISSION shRNA Bacterial Glycerol Stock
tandem C2 domains, nuclear
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028924.1-2342s1c1
Sequence:CCGGGCTGAAGAGACAGCTTGACATCTCGAGATGTCAAGCTGTCTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028924.1-1080s1c1
Sequence:CCGGGCCCAGGTTTAAATTATCTTACTCGAGTAAGATAATTTAAACCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028924.1-1868s1c1
Sequence:CCGGTGGAAATAATAGCACCTTCAACTCGAGTTGAAGGTGCTATTATTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028924.1-1481s1c1
Sequence:CCGGGCCTGGATACAATTACCCTATCTCGAGATAGGGTAATTGTATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028924.1-1261s1c1
Sequence:CCGGCCTGATTTAAGTAGGCGCTTTCTCGAGAAAGCGCCTACTTAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028924.2-978s21c1
Sequence:CCGGATGGATCTGTTTGTGATTTAACTCGAGTTAAATCACAAACAGATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028924.2-2133s21c1
Sequence:CCGGAGTAGCATTTGGCCAACTTAACTCGAGTTAAGTTGGCCAAATGCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028924.2-653s21c1
Sequence:CCGGTTGACTTCTGTTCTAGTAAAGCTCGAGCTTTACTAGAACAGAAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028924.2-1885s21c1
Sequence:CCGGGATAAGTGAAGACAGTAATAACTCGAGTTATTACTGTCTTCACTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028924
TC2N MISSION shRNA shRNA Plasmid DNA
tandem C2 domains, nuclear
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028924.1-2342s1c1
Sequence:CCGGGCTGAAGAGACAGCTTGACATCTCGAGATGTCAAGCTGTCTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028924.1-1080s1c1
Sequence:CCGGGCCCAGGTTTAAATTATCTTACTCGAGTAAGATAATTTAAACCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028924.1-1868s1c1
Sequence:CCGGTGGAAATAATAGCACCTTCAACTCGAGTTGAAGGTGCTATTATTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028924.1-1481s1c1
Sequence:CCGGGCCTGGATACAATTACCCTATCTCGAGATAGGGTAATTGTATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028924.1-1261s1c1
Sequence:CCGGCCTGATTTAAGTAGGCGCTTTCTCGAGAAAGCGCCTACTTAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028924.2-978s21c1
Sequence:CCGGATGGATCTGTTTGTGATTTAACTCGAGTTAAATCACAAACAGATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028924.2-2133s21c1
Sequence:CCGGAGTAGCATTTGGCCAACTTAACTCGAGTTAAGTTGGCCAAATGCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028924.2-653s21c1
Sequence:CCGGTTGACTTCTGTTCTAGTAAAGCTCGAGCTTTACTAGAACAGAAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028924.2-1885s21c1
Sequence:CCGGGATAAGTGAAGACAGTAATAACTCGAGTTATTACTGTCTTCACTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028924
TC2N MISSION shRNA Lentiviral Transduction Particles
tandem C2 domains, nuclear
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028924.1-2342s1c1
Sequence:CCGGGCTGAAGAGACAGCTTGACATCTCGAGATGTCAAGCTGTCTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028924.1-1080s1c1
Sequence:CCGGGCCCAGGTTTAAATTATCTTACTCGAGTAAGATAATTTAAACCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028924.1-1868s1c1
Sequence:CCGGTGGAAATAATAGCACCTTCAACTCGAGTTGAAGGTGCTATTATTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028924.1-1481s1c1
Sequence:CCGGGCCTGGATACAATTACCCTATCTCGAGATAGGGTAATTGTATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028924.1-1261s1c1
Sequence:CCGGCCTGATTTAAGTAGGCGCTTTCTCGAGAAAGCGCCTACTTAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028924.2-978s21c1
Sequence:CCGGATGGATCTGTTTGTGATTTAACTCGAGTTAAATCACAAACAGATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028924.2-2133s21c1
Sequence:CCGGAGTAGCATTTGGCCAACTTAACTCGAGTTAAGTTGGCCAAATGCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028924.2-653s21c1
Sequence:CCGGTTGACTTCTGTTCTAGTAAAGCTCGAGCTTTACTAGAACAGAAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028924.2-1885s21c1
Sequence:CCGGGATAAGTGAAGACAGTAATAACTCGAGTTATTACTGTCTTCACTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks