EMAIL THIS PAGE TO A FRIEND

TCAIM

T cell activation inhibitor, mitochondrial

Synonyms: C3orf23 TOAG-1 TOAG1
Gene ID:
Mouse(382117) T cell activation inhibitor, mitochondrial
Rat(363169) T cell activation inhibitor, mitochondrial
cow(515010) T cell activation inhibitor, mitochondrial
sheep(101118995) T cell activation inhibitor, mitochondrial
naked mole-rat(101707614) T cell activation inhibitor, mitochondrial
domestic guinea pig(100714703) T cell activation inhibitor, mitochondrial
domestic cat(101098888) T cell activation inhibitor, mitochondrial
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301601 ANTI-CC023 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB2107060 Anti-D9ERTD402E antibody produced in rabbit affinity isolated antibody human, guinea pig, horse, rabbit, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013405 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013405 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013405 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173826 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173826 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173826 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029839 Rosetta Predictions human pricing
NM_001029840 Rosetta Predictions human pricing
NM_173826 Rosetta Predictions human pricing
NM_001110838 Rosetta Predictions rat pricing
NM_001013405 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099441 predicted 1117
2 SASI_Hs01_00099442 predicted 685
3 SASI_Hs01_00099443 predicted 720
4 SASI_Hs02_00307521 predicted 527
5 SASI_Hs01_00099444 predicted 586
6 SASI_Hs01_00099445 predicted 711
7 SASI_Hs02_00307522 predicted 720
8 SASI_Hs01_00099446 predicted 1133
9 SASI_Hs01_00099448 predicted 1291
10 SASI_Hs01_00099449 predicted 1275
11 SASI_Hs01_00099447 predicted 1079
12 SASI_Hs01_00099450 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174926 predicted 931
2 SASI_Hs01_00174927 predicted 505
3 SASI_Hs01_00174928 predicted 538
4 SASI_Hs02_00307523 predicted 339
5 SASI_Hs01_00174929 predicted 407
6 SASI_Hs01_00174930 predicted 530
7 SASI_Hs02_00307524 predicted 532
8 SASI_Hs01_00174931 predicted 943
9 SASI_Hs01_00174933 predicted 1106
10 SASI_Hs01_00174934 predicted 1090
11 SASI_Hs01_00174932 predicted 959
12 SASI_Hs01_00174935 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226849 predicted 832
2 SASI_Hs01_00226851 predicted 783
3 SASI_Hs01_00226852 predicted 1367
4 SASI_Hs01_00226853 predicted 1601
5 SASI_Hs01_00226854 predicted 1188
6 SASI_Hs01_00226855 predicted 1276
7 SASI_Hs01_00226856 predicted 917
8 SASI_Hs01_00226857 predicted 1315
9 SASI_Hs02_00368687 predicted 1767
10 SASI_Hs02_00368688 predicted 1511
11 SASI_Hs01_00226850 predicted 683
12 SASI_Hs01_00226858 predicted 1341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110838 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251392 predicted 1073
2 SASI_Rn02_00251393 predicted 521
3 SASI_Rn02_00251394 predicted 345
4 SASI_Rn02_00251395 predicted 476
5 SASI_Rn02_00251396 predicted 1035
6 SASI_Rn02_00251397 predicted 847
7 SASI_Rn02_00251398 predicted 645
8 SASI_Rn02_00251399 predicted 497
9 SASI_Rn02_00251400 predicted 1122
10 SASI_Rn02_00251401 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158379 predicted 705
2 SASI_Mm02_00287226 predicted 1622
3 SASI_Mm01_00158380 predicted 379
4 SASI_Mm01_00158381 predicted 667
5 SASI_Mm01_00158382 predicted 506
6 SASI_Mm01_00158383 predicted 1111
7 SASI_Mm01_00158384 predicted 1629
8 SASI_Mm01_00158385 predicted 529
9 SASI_Mm01_00158386 predicted 501
10 SASI_Mm01_00158387 predicted 324
11 SASI_Mm01_00158388 predicted 471
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013405
VALIDATED
TCAIM MISSION shRNA Bacterial Glycerol Stock
T cell activation inhibitor, mitochondrial
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013405.1-1035s21c1
Sequence:CCGGTTGAAAGCTTGCCAAGTTATTCTCGAGAATAACTTGGCAAGCTTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013405.1-934s21c1
Sequence:CCGGGAAAGGATGCACGGTTGTATTCTCGAGAATACAACCGTGCATCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013405.1-631s21c1
Sequence:CCGGATGGCATAGGTCCTATTATTCCTCGAGGAATAATAGGACCTATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013405.1-2326s21c1
Sequence:CCGGTGAGTAAGATGTAGGATTATACTCGAGTATAATCCTACATCTTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013405.1-466s21c1
Sequence:CCGGATTCCGAGCAGTCAGATTTACCTCGAGGTAAATCTGACTGCTCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200974    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013405.1-1823s1c1
Sequence:CCGGCCCTAGACTTATGATGCTGATCTCGAGATCAGCATCATAAGTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013405.1-643s1c1
Sequence:CCGGCTATTATTCCTTTACTGGGTTCTCGAGAACCCAGTAAAGGAATAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013405.1-499s1c1
Sequence:CCGGCGATCTGCTAAGCACAGTATTCTCGAGAATACTGTGCTTAGCAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013405
VALIDATED
TCAIM MISSION shRNA shRNA Plasmid DNA
T cell activation inhibitor, mitochondrial
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013405.1-1035s21c1
Sequence:CCGGTTGAAAGCTTGCCAAGTTATTCTCGAGAATAACTTGGCAAGCTTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013405.1-934s21c1
Sequence:CCGGGAAAGGATGCACGGTTGTATTCTCGAGAATACAACCGTGCATCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013405.1-631s21c1
Sequence:CCGGATGGCATAGGTCCTATTATTCCTCGAGGAATAATAGGACCTATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013405.1-2326s21c1
Sequence:CCGGTGAGTAAGATGTAGGATTATACTCGAGTATAATCCTACATCTTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013405.1-466s21c1
Sequence:CCGGATTCCGAGCAGTCAGATTTACCTCGAGGTAAATCTGACTGCTCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200974    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013405.1-1823s1c1
Sequence:CCGGCCCTAGACTTATGATGCTGATCTCGAGATCAGCATCATAAGTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013405.1-643s1c1
Sequence:CCGGCTATTATTCCTTTACTGGGTTCTCGAGAACCCAGTAAAGGAATAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013405.1-499s1c1
Sequence:CCGGCGATCTGCTAAGCACAGTATTCTCGAGAATACTGTGCTTAGCAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013405
VALIDATED
TCAIM MISSION shRNA Lentiviral Transduction Particles
T cell activation inhibitor, mitochondrial
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013405.1-1035s21c1
Sequence:CCGGTTGAAAGCTTGCCAAGTTATTCTCGAGAATAACTTGGCAAGCTTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013405.1-934s21c1
Sequence:CCGGGAAAGGATGCACGGTTGTATTCTCGAGAATACAACCGTGCATCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013405.1-631s21c1
Sequence:CCGGATGGCATAGGTCCTATTATTCCTCGAGGAATAATAGGACCTATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013405.1-2326s21c1
Sequence:CCGGTGAGTAAGATGTAGGATTATACTCGAGTATAATCCTACATCTTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001013405.1-466s21c1
Sequence:CCGGATTCCGAGCAGTCAGATTTACCTCGAGGTAAATCTGACTGCTCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200974    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013405.1-1823s1c1
Sequence:CCGGCCCTAGACTTATGATGCTGATCTCGAGATCAGCATCATAAGTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013405.1-643s1c1
Sequence:CCGGCTATTATTCCTTTACTGGGTTCTCGAGAACCCAGTAAAGGAATAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013405.1-499s1c1
Sequence:CCGGCGATCTGCTAAGCACAGTATTCTCGAGAATACTGTGCTTAGCAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173826
VALIDATED
TCAIM MISSION shRNA Bacterial Glycerol Stock
T cell activation inhibitor, mitochondrial
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173826.3-1508s21c1
Sequence:CCGGCCTCGAAGTTTGCGTGGTTTACTCGAGTAAACCACGCAAACTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173826.3-1154s21c1
Sequence:CCGGTGTAGCCAGCTGCATAGTTTACTCGAGTAAACTATGCAGCTGGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173826.3-1610s21c1
Sequence:GTACCGGGCAAATCTCCAGTGGTTTATTCTCGAGAATAAACCACTGGAGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173826.3-994s21c1
Sequence:GTACCGGTCTCACATCCTGGTTAGATAACTCGAGTTATCTAACCAGGATGTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173826.3-3154s21c1
Sequence:CCGGAGATACCTTCGGGCAATATTTCTCGAGAAATATTGCCCGAAGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173826.1-2236s1c1
Sequence:CCGGGCAGCCAGTAATTGACAGTTACTCGAGTAACTGTCAATTACTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173826.1-1429s1c1
Sequence:CCGGCCAGCATTTCTAGTATACAAACTCGAGTTTGTATACTAGAAATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173826.1-2372s1c1
Sequence:CCGGGCAGTCTGATAACCAGTTTATCTCGAGATAAACTGGTTATCAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173826.1-496s1c1
Sequence:CCGGGCAGTTTATCTGTTGAACATACTCGAGTATGTTCAACAGATAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173826.1-3123s1c1
Sequence:CCGGCGTGCCTAACAACTGTACTTACTCGAGTAAGTACAGTTGTTAGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173826.1-943s1c1
Sequence:CCGGGCCATGTGATGCTAGGAACAACTCGAGTTGTTCCTAGCATCACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173826
VALIDATED
TCAIM MISSION shRNA shRNA Plasmid DNA
T cell activation inhibitor, mitochondrial
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173826.3-1508s21c1
Sequence:CCGGCCTCGAAGTTTGCGTGGTTTACTCGAGTAAACCACGCAAACTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173826.3-1154s21c1
Sequence:CCGGTGTAGCCAGCTGCATAGTTTACTCGAGTAAACTATGCAGCTGGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173826.3-1610s21c1
Sequence:GTACCGGGCAAATCTCCAGTGGTTTATTCTCGAGAATAAACCACTGGAGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173826.3-994s21c1
Sequence:GTACCGGTCTCACATCCTGGTTAGATAACTCGAGTTATCTAACCAGGATGTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173826.3-3154s21c1
Sequence:CCGGAGATACCTTCGGGCAATATTTCTCGAGAAATATTGCCCGAAGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173826.1-2236s1c1
Sequence:CCGGGCAGCCAGTAATTGACAGTTACTCGAGTAACTGTCAATTACTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173826.1-1429s1c1
Sequence:CCGGCCAGCATTTCTAGTATACAAACTCGAGTTTGTATACTAGAAATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173826.1-2372s1c1
Sequence:CCGGGCAGTCTGATAACCAGTTTATCTCGAGATAAACTGGTTATCAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173826.1-496s1c1
Sequence:CCGGGCAGTTTATCTGTTGAACATACTCGAGTATGTTCAACAGATAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173826.1-3123s1c1
Sequence:CCGGCGTGCCTAACAACTGTACTTACTCGAGTAAGTACAGTTGTTAGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173826.1-943s1c1
Sequence:CCGGGCCATGTGATGCTAGGAACAACTCGAGTTGTTCCTAGCATCACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173826
VALIDATED
TCAIM MISSION shRNA Lentiviral Transduction Particles
T cell activation inhibitor, mitochondrial
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173826.3-1508s21c1
Sequence:CCGGCCTCGAAGTTTGCGTGGTTTACTCGAGTAAACCACGCAAACTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173826.3-1154s21c1
Sequence:CCGGTGTAGCCAGCTGCATAGTTTACTCGAGTAAACTATGCAGCTGGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173826.3-1610s21c1
Sequence:GTACCGGGCAAATCTCCAGTGGTTTATTCTCGAGAATAAACCACTGGAGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173826.3-994s21c1
Sequence:GTACCGGTCTCACATCCTGGTTAGATAACTCGAGTTATCTAACCAGGATGTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173826.3-3154s21c1
Sequence:CCGGAGATACCTTCGGGCAATATTTCTCGAGAAATATTGCCCGAAGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173826.1-2236s1c1
Sequence:CCGGGCAGCCAGTAATTGACAGTTACTCGAGTAACTGTCAATTACTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173826.1-1429s1c1
Sequence:CCGGCCAGCATTTCTAGTATACAAACTCGAGTTTGTATACTAGAAATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173826.1-2372s1c1
Sequence:CCGGGCAGTCTGATAACCAGTTTATCTCGAGATAAACTGGTTATCAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173826.1-496s1c1
Sequence:CCGGGCAGTTTATCTGTTGAACATACTCGAGTATGTTCAACAGATAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173826.1-3123s1c1
Sequence:CCGGCGTGCCTAACAACTGTACTTACTCGAGTAAGTACAGTTGTTAGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173826.1-943s1c1
Sequence:CCGGGCCATGTGATGCTAGGAACAACTCGAGTTGTTCCTAGCATCACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks