EMAIL THIS PAGE TO A FRIEND

TCAP

titin-cap

Synonyms: CMD1N LGMD2G T-cap TELE telethonin
UniProtKB ID: O15273, Q96L27
Gene ID:
Human(8557) Summary: Sarcomere assembly is regulated by the muscle protein titin. Titin is a giant elastic protein with kinase activity that extends half the length of a sarcomere. It serves as a scaffold to which myofibrils and other muscle related proteins are attached. This gene encodes a protein found in striated and cardiac muscle that binds to the titin Z1-Z2 domains and is a substrate of titin kinase, interactions thought to be critical to sarcomere assembly. Mutations in this gene are associated with limb-girdle muscular dystrophy type 2G. [provided by RefSeq, Jul 2008]
Mouse(21393) titin-cap
Rat(688173) titin-cap
Zebrafish(556258) titin-cap (telethonin)
dog(608508) titin-cap
cow(513257) titin-cap (telethonin)
Goat(100861162) titin-cap
sheep(101103739) titin-cap
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003673 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003673 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003673 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011540 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011540 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011540 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028851 MISSION® esiRNA esiRNA human TCAP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003673 Rosetta Predictions human pricing
XM_001081394 Rosetta Predictions rat pricing
NM_011540 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003673 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185238 predicted 693
2 SASI_Hs01_00185239 predicted 266
3 SASI_Hs01_00185240 predicted 212
4 SASI_Hs01_00185241 predicted 603
5 SASI_Hs01_00185242 predicted 710
6 SASI_Hs01_00185243 predicted 507
7 SASI_Hs01_00185244 predicted 600
8 SASI_Hs01_00185245 predicted 519
9 SASI_Hs01_00185246 predicted 708
10 SASI_Hs02_00336076 predicted 704
11 SASI_Hs01_00185247 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081394 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371709 predicted 532
2 SASI_Rn02_00371710 predicted 749
3 SASI_Rn02_00371711 predicted 221
4 SASI_Rn02_00371712 predicted 566
5 SASI_Rn02_00371713 predicted 613
6 SASI_Rn02_00371714 predicted 197
7 SASI_Rn02_00371715 predicted 751
8 SASI_Rn02_00371716 predicted 605
9 SASI_Rn02_00371717 predicted 484
10 SASI_Rn02_00371718 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011540 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320870 predicted 585
2 SASI_Mm02_00320871 predicted 585
3 SASI_Mm02_00320872 predicted 544
4 SASI_Mm02_00320873 predicted 506
5 SASI_Mm02_00320874 predicted 534
6 SASI_Mm02_00320875 predicted 564
7 SASI_Mm02_00320876 predicted 577
8 SASI_Mm02_00320877 predicted 540
9 SASI_Mm02_00320878 predicted 620
10 SASI_Mm02_00320879 predicted 532
11 SASI_Mm01_00200015 predicted 809
12 SASI_Mm01_00200016 predicted 949
13 SASI_Mm01_00200017 predicted 930
14 SASI_Mm01_00200018 predicted 918
15 SASI_Mm01_00200019 predicted 916
16 SASI_Mm01_00200020 predicted 938
17 SASI_Mm01_00200021 predicted 945
18 SASI_Mm01_00200022 predicted 217
19 SASI_Mm01_00200023 predicted 846
20 SASI_Mm01_00200024 predicted 938
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003673
TCAP MISSION shRNA Bacterial Glycerol Stock
titin-cap
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003673.3-410s21c1
Sequence:CCGGGGTGGCTGAGATCACAAAGCACTCGAGTGCTTTGTGATCTCAGCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003673.3-40s21c1
Sequence:CCGGAGGTGTCGGAGGAGAACTGTGCTCGAGCACAGTTCTCCTCCGACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003673.3-776s21c1
Sequence:CCGGAGGTACTGGTGAGGGCAAGAGCTCGAGCTCTTGCCCTCACCAGTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003673.3-597s21c1
Sequence:CCGGGGCCATGGCTGCTTTGTAGTTCTCGAGAACTACAAAGCAGCCATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003673.2-81s1c1
Sequence:CCGGGCAGAATGGAAGGATCTGACACTCGAGTGTCAGATCCTTCCATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003673.2-138s1c1
Sequence:CCGGGAGGAGGACACCCAGAGACATCTCGAGATGTCTCTGGGTGTCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003673.2-608s1c1
Sequence:CCGGCTTTGTAGTTTGCCCAGAGTTCTCGAGAACTCTGGGCAAACTACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003673.2-483s1c1
Sequence:CCGGTCCCGCTCCATGTCCCAGGAACTCGAGTTCCTGGGACATGGAGCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003673.2-314s1c1
Sequence:CCGGCGCCACCAAGGAGGAGCGTGACTCGAGTCACGCTCCTCCTTGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003673
TCAP MISSION shRNA shRNA Plasmid DNA
titin-cap
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003673.3-410s21c1
Sequence:CCGGGGTGGCTGAGATCACAAAGCACTCGAGTGCTTTGTGATCTCAGCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003673.3-40s21c1
Sequence:CCGGAGGTGTCGGAGGAGAACTGTGCTCGAGCACAGTTCTCCTCCGACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003673.3-776s21c1
Sequence:CCGGAGGTACTGGTGAGGGCAAGAGCTCGAGCTCTTGCCCTCACCAGTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003673.3-597s21c1
Sequence:CCGGGGCCATGGCTGCTTTGTAGTTCTCGAGAACTACAAAGCAGCCATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003673.2-81s1c1
Sequence:CCGGGCAGAATGGAAGGATCTGACACTCGAGTGTCAGATCCTTCCATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003673.2-138s1c1
Sequence:CCGGGAGGAGGACACCCAGAGACATCTCGAGATGTCTCTGGGTGTCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003673.2-608s1c1
Sequence:CCGGCTTTGTAGTTTGCCCAGAGTTCTCGAGAACTCTGGGCAAACTACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003673.2-483s1c1
Sequence:CCGGTCCCGCTCCATGTCCCAGGAACTCGAGTTCCTGGGACATGGAGCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003673.2-314s1c1
Sequence:CCGGCGCCACCAAGGAGGAGCGTGACTCGAGTCACGCTCCTCCTTGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003673
TCAP MISSION shRNA Lentiviral Transduction Particles
titin-cap
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003673.3-410s21c1
Sequence:CCGGGGTGGCTGAGATCACAAAGCACTCGAGTGCTTTGTGATCTCAGCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003673.3-40s21c1
Sequence:CCGGAGGTGTCGGAGGAGAACTGTGCTCGAGCACAGTTCTCCTCCGACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003673.3-776s21c1
Sequence:CCGGAGGTACTGGTGAGGGCAAGAGCTCGAGCTCTTGCCCTCACCAGTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003673.3-597s21c1
Sequence:CCGGGGCCATGGCTGCTTTGTAGTTCTCGAGAACTACAAAGCAGCCATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003673.2-81s1c1
Sequence:CCGGGCAGAATGGAAGGATCTGACACTCGAGTGTCAGATCCTTCCATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003673.2-138s1c1
Sequence:CCGGGAGGAGGACACCCAGAGACATCTCGAGATGTCTCTGGGTGTCCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003673.2-608s1c1
Sequence:CCGGCTTTGTAGTTTGCCCAGAGTTCTCGAGAACTCTGGGCAAACTACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003673.2-483s1c1
Sequence:CCGGTCCCGCTCCATGTCCCAGGAACTCGAGTTCCTGGGACATGGAGCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003673.2-314s1c1
Sequence:CCGGCGCCACCAAGGAGGAGCGTGACTCGAGTCACGCTCCTCCTTGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011540
TCAP MISSION shRNA Bacterial Glycerol Stock
titin-cap
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011540.1-767s1c1
Sequence:CCGGCCAGAAGAAGAGACAAGAGATCTCGAGATCTCTTGTCTCTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011540.1-222s1c1
Sequence:CCGGGCGCTCACCATGGCTGGTGATCTCGAGATCACCAGCCATGGTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011540.1-105s1c1
Sequence:CCGGTGAGTGGAAAGACCTGACTCTCTCGAGAGAGTCAGGTCTTTCCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011540.1-234s1c1
Sequence:CCGGGCTGGTGATGCGCCTGGGTATCTCGAGATACCCAGGCGCATCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011540.1-505s1c1
Sequence:CCGGTCTCGATCCATGTCTCAGGAACTCGAGTTCCTGAGACATGGATCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011540
TCAP MISSION shRNA shRNA Plasmid DNA
titin-cap
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011540.1-767s1c1
Sequence:CCGGCCAGAAGAAGAGACAAGAGATCTCGAGATCTCTTGTCTCTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011540.1-222s1c1
Sequence:CCGGGCGCTCACCATGGCTGGTGATCTCGAGATCACCAGCCATGGTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011540.1-105s1c1
Sequence:CCGGTGAGTGGAAAGACCTGACTCTCTCGAGAGAGTCAGGTCTTTCCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011540.1-234s1c1
Sequence:CCGGGCTGGTGATGCGCCTGGGTATCTCGAGATACCCAGGCGCATCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011540.1-505s1c1
Sequence:CCGGTCTCGATCCATGTCTCAGGAACTCGAGTTCCTGAGACATGGATCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011540
TCAP MISSION shRNA Lentiviral Transduction Particles
titin-cap
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011540.1-767s1c1
Sequence:CCGGCCAGAAGAAGAGACAAGAGATCTCGAGATCTCTTGTCTCTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011540.1-222s1c1
Sequence:CCGGGCGCTCACCATGGCTGGTGATCTCGAGATCACCAGCCATGGTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011540.1-105s1c1
Sequence:CCGGTGAGTGGAAAGACCTGACTCTCTCGAGAGAGTCAGGTCTTTCCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011540.1-234s1c1
Sequence:CCGGGCTGGTGATGCGCCTGGGTATCTCGAGATACCCAGGCGCATCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011540.1-505s1c1
Sequence:CCGGTCTCGATCCATGTCTCAGGAACTCGAGTTCCTGAGACATGGATCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks