EMAIL THIS PAGE TO A FRIEND

TCEA1

transcription elongation factor A (SII), 1

Synonyms: GTF2S SII TCEA TF2S TFIIS
UniProtKB ID: P23193, A6NF25, A8K339, Q15563, Q6FG87
Gene ID:
Mouse(21399) transcription elongation factor A (SII) 1
Rat(362479) transcription elongation factor A (SII) 1
cow(505722) transcription elongation factor A (SII), 1
sheep(101107711) transcription elongation factor A (SII), 1
domestic guinea pig(100715960) transcription elongation factor A (SII), 1
naked mole-rat(101710006) transcription elongation factor A (SII), 1
Zebrafish(336105) transcription elongation factor A (SII), 1
chicken(421119) transcription elongation factor A (SII), 1
domestic cat(101080425) transcription elongation factor A (SII), 1
dog(477879) transcription elongation factor A (SII), 1
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV38858 Anti-TCEA1 (AB1) antibody produced in rabbit IgG fraction of antiserum , guinea pig, rat, rabbit, human, zebrafish, mouse, bovine, canine
western blot pricing
AV37150 Anti-TCEA1 (AB2) antibody produced in rabbit IgG fraction of antiserum horse, bovine, rat, rabbit, mouse, guinea pig, canine, human
western blot pricing
AV33407 Anti-TCEA1 antibody produced in rabbit affinity isolated antibody human, mouse, guinea pig, horse, rabbit, canine, rat
western blot pricing
HPA043786 Anti-TCEA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB2106465 Anti-TCEA1 antibody produced in rabbit affinity isolated antibody horse, guinea pig, human, rabbit, rat
ELISA, western blot pricing
SAB2105316 Anti-TCEA1, (N-terminal) antibody produced in rabbit affinity isolated antibody horse, guinea pig, mouse, rabbit
western blot pricing
SAB1402371 Monoclonal Anti-TCEA1 antibody produced in mouse clone 1B7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006756 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006756 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006756 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011541 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011541 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011541 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU203431 MISSION® esiRNA esiRNA targeting mouse Tcea1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006756 Rosetta Predictions human pricing
NM_201437 Rosetta Predictions human pricing
NM_001025735 Rosetta Predictions rat pricing
NM_011541 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217094 predicted 1171
2 SASI_Hs01_00217095 predicted 1174
3 SASI_Hs01_00217097 predicted 1091
4 SASI_Hs01_00217098 predicted 1102
5 SASI_Hs02_00342233 predicted 679
6 SASI_Hs01_00217099 predicted 1039
7 SASI_Hs01_00217100 predicted 1135
8 SASI_Hs01_00217101 predicted 1214
9 SASI_Hs02_00342234 predicted 829
10 SASI_Hs01_00217102 predicted 1196
11 SASI_Hs01_00217093 predicted 736
12 SASI_Hs01_00217096 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095109 predicted 1106
2 SASI_Hs01_00095110 predicted 1113
3 SASI_Hs01_00095112 predicted 1030
4 SASI_Hs01_00095113 predicted 1038
5 SASI_Hs02_00372975 predicted 609
6 SASI_Hs01_00095114 predicted 980
7 SASI_Hs01_00095115 predicted 1066
8 SASI_Hs01_00095116 predicted 1149
9 SASI_Hs02_00372976 predicted 762
10 SASI_Hs01_00095117 predicted 1140
11 SASI_Hs01_00095108 predicted 669
12 SASI_Hs01_00095111 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025735 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121755 predicted 262
2 SASI_Rn02_00203373 predicted 848
3 SASI_Rn01_00121757 predicted 401
4 SASI_Rn01_00121758 predicted 227
5 SASI_Rn01_00121759 predicted 216
6 SASI_Rn01_00121760 predicted 482
7 SASI_Rn01_00121761 predicted 491
8 SASI_Rn01_00121762 predicted 595
9 SASI_Rn01_00121763 predicted 265
10 SASI_Rn01_00121764 predicted 1078
11 SASI_Rn01_00121756 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011541 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320880 predicted 1095
2 SASI_Mm02_00320881 predicted 742
3 SASI_Mm02_00320882 predicted 475
4 SASI_Mm02_00320883 predicted 957
5 SASI_Mm02_00320884 predicted 687
6 SASI_Mm02_00320885 predicted 884
7 SASI_Mm02_00320886 predicted 924
8 SASI_Mm02_00320887 predicted 248
9 SASI_Mm02_00320888 predicted 1022
10 SASI_Mm02_00320889 predicted 286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006756
VALIDATED
TCEA1 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII), 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006756.x-1750s1c1
Sequence:CCGGTGTTGTAGTTTAGAAGGCTTTCTCGAGAAAGCCTTCTAAACTACAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006756.x-237s1c1
Sequence:CCGGAGAATCGGAATGTCAGTTAATCTCGAGATTAACTGACATTCCGATTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006756.x-524s1c1
Sequence:CCGGGCGGTTGAAGTGTAGGGAGATCTCGAGATCTCCCTACACTTCAACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006756.x-370s1c1
Sequence:CCGGAGAAGAAAGAACCTGCAATTACTCGAGTAATTGCAGGTTCTTTCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006756.2-461s21c1
Sequence:CCGGCGGAATGTCAGTTAATGCTATCTCGAGATAGCATTAACTGACATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006756.2-889s21c1
Sequence:CCGGATAGAGTACGAAGTAGGATATCTCGAGATATCCTACTTCGTACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006756.2-589s21c1
Sequence:CCGGAGAAGAAAGAACCTGCAATTACTCGAGTAATTGCAGGTTCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_006756.2-743s21c1
Sequence:CCGGGCGGTTGAAGTGTAGGGAGATCTCGAGATCTCCCTACACTTCAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006756.2-1969s21c1
Sequence:CCGGTGTTGTAGTTTAGAAGGCTTTCTCGAGAAAGCCTTCTAAACTACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006756
VALIDATED
TCEA1 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII), 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006756.x-1750s1c1
Sequence:CCGGTGTTGTAGTTTAGAAGGCTTTCTCGAGAAAGCCTTCTAAACTACAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006756.x-237s1c1
Sequence:CCGGAGAATCGGAATGTCAGTTAATCTCGAGATTAACTGACATTCCGATTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006756.x-524s1c1
Sequence:CCGGGCGGTTGAAGTGTAGGGAGATCTCGAGATCTCCCTACACTTCAACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006756.x-370s1c1
Sequence:CCGGAGAAGAAAGAACCTGCAATTACTCGAGTAATTGCAGGTTCTTTCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006756.2-461s21c1
Sequence:CCGGCGGAATGTCAGTTAATGCTATCTCGAGATAGCATTAACTGACATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006756.2-889s21c1
Sequence:CCGGATAGAGTACGAAGTAGGATATCTCGAGATATCCTACTTCGTACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006756.2-589s21c1
Sequence:CCGGAGAAGAAAGAACCTGCAATTACTCGAGTAATTGCAGGTTCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_006756.2-743s21c1
Sequence:CCGGGCGGTTGAAGTGTAGGGAGATCTCGAGATCTCCCTACACTTCAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006756.2-1969s21c1
Sequence:CCGGTGTTGTAGTTTAGAAGGCTTTCTCGAGAAAGCCTTCTAAACTACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006756
VALIDATED
TCEA1 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII), 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006756.x-1750s1c1
Sequence:CCGGTGTTGTAGTTTAGAAGGCTTTCTCGAGAAAGCCTTCTAAACTACAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006756.x-237s1c1
Sequence:CCGGAGAATCGGAATGTCAGTTAATCTCGAGATTAACTGACATTCCGATTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006756.x-524s1c1
Sequence:CCGGGCGGTTGAAGTGTAGGGAGATCTCGAGATCTCCCTACACTTCAACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006756.x-370s1c1
Sequence:CCGGAGAAGAAAGAACCTGCAATTACTCGAGTAATTGCAGGTTCTTTCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006756.2-461s21c1
Sequence:CCGGCGGAATGTCAGTTAATGCTATCTCGAGATAGCATTAACTGACATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006756.2-889s21c1
Sequence:CCGGATAGAGTACGAAGTAGGATATCTCGAGATATCCTACTTCGTACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006756.2-589s21c1
Sequence:CCGGAGAAGAAAGAACCTGCAATTACTCGAGTAATTGCAGGTTCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_006756.2-743s21c1
Sequence:CCGGGCGGTTGAAGTGTAGGGAGATCTCGAGATCTCCCTACACTTCAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006756.2-1969s21c1
Sequence:CCGGTGTTGTAGTTTAGAAGGCTTTCTCGAGAAAGCCTTCTAAACTACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011541
VALIDATED
TCEA1 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII), 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011541.3-1899s1c1
Sequence:CCGGCCTCCTTTAGACTGAATCTTTCTCGAGAAAGATTCAGTCTAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011541.3-924s1c1
Sequence:CCGGGCACTTATACACAGGTGCAAACTCGAGTTTGCACCTGTGTATAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011541.3-516s1c1
Sequence:CCGGGCACTTCTGATTCTGTGCGATCTCGAGATCGCACAGAATCAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011541.3-453s1c1
Sequence:CCGGGCAGCAGAAAGGATGAGACAACTCGAGTTGTCTCATCCTTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011541.3-519s1c1
Sequence:CCGGCTTCTGATTCTGTGCGATTAACTCGAGTTAATCGCACAGAATCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011541.4-627s21c1
Sequence:CCGGCTTCTGATTCTGTGCGATTAACTCGAGTTAATCGCACAGAATCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011541.4-730s21c1
Sequence:CCGGTCAGATTGAGGAAGCTATATACTCGAGTATATAGCTTCCTCAATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011541.4-1142s21c1
Sequence:CCGGCAAAGTATCTGGACCATTAAGCTCGAGCTTAATGGTCCAGATACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011541.4-859s21c1
Sequence:CCGGGAATATTCCTCCTGATCTATTCTCGAGAATAGATCAGGAGGAATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011541.4-674s21c1
Sequence:CCGGCTTCGGACAGGAGATGATTATCTCGAGATAATCATCTCCTGTCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011541
VALIDATED
TCEA1 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII), 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011541.3-1899s1c1
Sequence:CCGGCCTCCTTTAGACTGAATCTTTCTCGAGAAAGATTCAGTCTAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011541.3-924s1c1
Sequence:CCGGGCACTTATACACAGGTGCAAACTCGAGTTTGCACCTGTGTATAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011541.3-516s1c1
Sequence:CCGGGCACTTCTGATTCTGTGCGATCTCGAGATCGCACAGAATCAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011541.3-453s1c1
Sequence:CCGGGCAGCAGAAAGGATGAGACAACTCGAGTTGTCTCATCCTTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011541.3-519s1c1
Sequence:CCGGCTTCTGATTCTGTGCGATTAACTCGAGTTAATCGCACAGAATCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011541.4-627s21c1
Sequence:CCGGCTTCTGATTCTGTGCGATTAACTCGAGTTAATCGCACAGAATCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011541.4-730s21c1
Sequence:CCGGTCAGATTGAGGAAGCTATATACTCGAGTATATAGCTTCCTCAATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011541.4-1142s21c1
Sequence:CCGGCAAAGTATCTGGACCATTAAGCTCGAGCTTAATGGTCCAGATACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011541.4-859s21c1
Sequence:CCGGGAATATTCCTCCTGATCTATTCTCGAGAATAGATCAGGAGGAATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011541.4-674s21c1
Sequence:CCGGCTTCGGACAGGAGATGATTATCTCGAGATAATCATCTCCTGTCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011541
VALIDATED
TCEA1 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII), 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011541.3-1899s1c1
Sequence:CCGGCCTCCTTTAGACTGAATCTTTCTCGAGAAAGATTCAGTCTAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011541.3-924s1c1
Sequence:CCGGGCACTTATACACAGGTGCAAACTCGAGTTTGCACCTGTGTATAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011541.3-516s1c1
Sequence:CCGGGCACTTCTGATTCTGTGCGATCTCGAGATCGCACAGAATCAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011541.3-453s1c1
Sequence:CCGGGCAGCAGAAAGGATGAGACAACTCGAGTTGTCTCATCCTTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011541.3-519s1c1
Sequence:CCGGCTTCTGATTCTGTGCGATTAACTCGAGTTAATCGCACAGAATCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011541.4-627s21c1
Sequence:CCGGCTTCTGATTCTGTGCGATTAACTCGAGTTAATCGCACAGAATCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011541.4-730s21c1
Sequence:CCGGTCAGATTGAGGAAGCTATATACTCGAGTATATAGCTTCCTCAATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011541.4-1142s21c1
Sequence:CCGGCAAAGTATCTGGACCATTAAGCTCGAGCTTAATGGTCCAGATACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011541.4-859s21c1
Sequence:CCGGGAATATTCCTCCTGATCTATTCTCGAGAATAGATCAGGAGGAATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011541.4-674s21c1
Sequence:CCGGCTTCGGACAGGAGATGATTATCTCGAGATAATCATCTCCTGTCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks