EMAIL THIS PAGE TO A FRIEND

TCEA2

transcription elongation factor A (SII), 2

Synonyms: TFIIS
UniProtKB ID: Q15560, B3KNM1, Q8TD37, Q8TD38
Gene ID:
Human(6919) Summary: The protein encoded by this gene is found in the nucleus, where it functions as an SII class transcription elongation factor. Elongation factors in this class are responsible for releasing RNA polymerase II ternary complexes from transcriptional arrest at template-encoded arresting sites. The encoded protein has been shown to interact with general transcription factor IIB, a basal transcription factor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(21400) transcription elongation factor A (SII), 2
Rat(29575) transcription elongation factor A (SII), 2
Zebrafish(393961) transcription elongation factor A (SII), 2
domestic cat(101094496) transcription elongation factor A (SII), 2
dog(480747) transcription elongation factor A (SII), 2
chicken(419253) transcription elongation factor A (SII), 2
cow(507729) transcription elongation factor A (SII), 2
sheep(101115815) transcription elongation factor A (SII), 2
naked mole-rat(101706089) transcription elongation factor A (SII), 2
domestic guinea pig(100714632) transcription elongation factor A (SII), 2
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003195 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003195 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003195 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009326 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009326 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009326 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003195 Rosetta Predictions human pricing
NM_198723 Rosetta Predictions human pricing
NM_057098 Rosetta Predictions rat pricing
NM_009326 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086430 predicted 1031
2 SASI_Hs01_00086431 predicted 1053
3 SASI_Hs01_00086432 predicted 1154
4 SASI_Hs01_00086433 predicted 1427
5 SASI_Hs01_00086434 predicted 1492
6 SASI_Hs01_00086435 predicted 1055
7 SASI_Hs01_00086436 predicted 1064
8 SASI_Hs01_00086437 predicted 1201
9 SASI_Hs01_00086438 predicted 1224
10 SASI_Hs01_00086439 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015495 predicted 945
2 SASI_Hs01_00015496 predicted 959
3 SASI_Hs01_00015497 predicted 1064
4 SASI_Hs01_00015498 predicted 1339
5 SASI_Hs01_00015499 predicted 1406
6 SASI_Hs01_00015500 predicted 966
7 SASI_Hs01_00015501 predicted 973
8 SASI_Hs01_00015502 predicted 1111
9 SASI_Hs01_00015503 predicted 1136
10 SASI_Hs01_00015504 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057098 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070023 predicted 636
2 SASI_Rn01_00070024 predicted 927
3 SASI_Rn01_00070025 predicted 420
4 SASI_Rn01_00070026 predicted 727
5 SASI_Rn01_00070027 predicted 217
6 SASI_Rn01_00070028 predicted 558
7 SASI_Rn01_00070029 predicted 629
8 SASI_Rn01_00070030 predicted 496
9 SASI_Rn01_00070031 predicted 393
10 SASI_Rn02_00267022 predicted 545
11 SASI_Rn01_00070032 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009326 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064441 predicted 844
2 SASI_Mm02_00315885 predicted 735
3 SASI_Mm01_00064442 predicted 274
4 SASI_Mm01_00064443 predicted 793
5 SASI_Mm02_00315886 predicted 460
6 SASI_Mm01_00064445 predicted 934
7 SASI_Mm01_00064447 predicted 451
8 SASI_Mm01_00064448 predicted 321
9 SASI_Mm01_00064449 predicted 694
10 SASI_Mm01_00064450 predicted 492
11 SASI_Mm01_00064444 predicted 586
12 SASI_Mm01_00064446 predicted 750
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003195
VALIDATED
TCEA2 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII), 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_003195.4-1187s1c1
Sequence:CCGGCGTTGGAAACACAGACATGAACTCGAGTTCATGTCTGTGTTTCCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_003195.4-1510s1c1
Sequence:CCGGCCTTTGTTGTCTGCAACGAGTCTCGAGACTCGTTGCAGACAACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_003195.4-1558s1c1
Sequence:CCGGCCCTCGTGTAGATGTGCTGCACTCGAGTGCAGCACATCTACACGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003195.4-1226s1c1
Sequence:CCGGGAGTCGTATCTCCAACCTGAACTCGAGTTCAGGTTGGAGATACGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003195.4-834s21c1
Sequence:CCGGAGCTCGGATGAGGAGGTCATTCTCGAGAATGACCTCCTCATCCGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003195.4-1020s21c1
Sequence:CCGGACTCCGAGGATCACCACATTTCTCGAGAAATGTGGTGATCCTCGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003195.4-1059s21c1
Sequence:CCGGTGTGATGCCGTGCGCAACAAGCTCGAGCTTGTTGCGCACGGCATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003195.4-895s21c1
Sequence:CCGGTGGATGCTTCCGATGCCAAAGCTCGAGCTTTGGCATCGGAAGCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003195.4-1534s21c1
Sequence:CCGGGAAACCGCTGGAAGTTCTGCTCTCGAGAGCAGAACTTCCAGCGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003195
VALIDATED
TCEA2 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII), 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_003195.4-1187s1c1
Sequence:CCGGCGTTGGAAACACAGACATGAACTCGAGTTCATGTCTGTGTTTCCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_003195.4-1510s1c1
Sequence:CCGGCCTTTGTTGTCTGCAACGAGTCTCGAGACTCGTTGCAGACAACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_003195.4-1558s1c1
Sequence:CCGGCCCTCGTGTAGATGTGCTGCACTCGAGTGCAGCACATCTACACGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003195.4-1226s1c1
Sequence:CCGGGAGTCGTATCTCCAACCTGAACTCGAGTTCAGGTTGGAGATACGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003195.4-834s21c1
Sequence:CCGGAGCTCGGATGAGGAGGTCATTCTCGAGAATGACCTCCTCATCCGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003195.4-1020s21c1
Sequence:CCGGACTCCGAGGATCACCACATTTCTCGAGAAATGTGGTGATCCTCGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003195.4-1059s21c1
Sequence:CCGGTGTGATGCCGTGCGCAACAAGCTCGAGCTTGTTGCGCACGGCATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003195.4-895s21c1
Sequence:CCGGTGGATGCTTCCGATGCCAAAGCTCGAGCTTTGGCATCGGAAGCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003195.4-1534s21c1
Sequence:CCGGGAAACCGCTGGAAGTTCTGCTCTCGAGAGCAGAACTTCCAGCGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003195
VALIDATED
TCEA2 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII), 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_003195.4-1187s1c1
Sequence:CCGGCGTTGGAAACACAGACATGAACTCGAGTTCATGTCTGTGTTTCCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_003195.4-1510s1c1
Sequence:CCGGCCTTTGTTGTCTGCAACGAGTCTCGAGACTCGTTGCAGACAACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_003195.4-1558s1c1
Sequence:CCGGCCCTCGTGTAGATGTGCTGCACTCGAGTGCAGCACATCTACACGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003195.4-1226s1c1
Sequence:CCGGGAGTCGTATCTCCAACCTGAACTCGAGTTCAGGTTGGAGATACGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003195.4-834s21c1
Sequence:CCGGAGCTCGGATGAGGAGGTCATTCTCGAGAATGACCTCCTCATCCGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003195.4-1020s21c1
Sequence:CCGGACTCCGAGGATCACCACATTTCTCGAGAAATGTGGTGATCCTCGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003195.4-1059s21c1
Sequence:CCGGTGTGATGCCGTGCGCAACAAGCTCGAGCTTGTTGCGCACGGCATCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003195.4-895s21c1
Sequence:CCGGTGGATGCTTCCGATGCCAAAGCTCGAGCTTTGGCATCGGAAGCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003195.4-1534s21c1
Sequence:CCGGGAAACCGCTGGAAGTTCTGCTCTCGAGAGCAGAACTTCCAGCGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009326
VALIDATED
TCEA2 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII), 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009326.1-236s1c1
Sequence:CCGGCGTGTTGGGATGTCTGTCAATCTCGAGATTGACAGACATCCCAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009326.1-940s1c1
Sequence:CCGGGCCCATGACTACCTATGTTGTCTCGAGACAACATAGGTAGTCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009326.1-667s1c1
Sequence:CCGGGAGCCGAATCTCTAACCTGAACTCGAGTTCAGGTTAGAGATTCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009326.1-715s1c1
Sequence:CCGGGAATGTGTTGTGTGGTGCCATCTCGAGATGGCACCACACAACACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009326.1-191s1c1
Sequence:CCGGGAGCTGAAGAATATGCCTATTCTCGAGAATAGGCATATTCTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009326.2-521s21c1
Sequence:CCGGTGCCGAGAGATGCTGACTTTGCTCGAGCAAAGTCAGCATCTCTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009326.2-667s21c1
Sequence:CCGGGAGCCGAATCTCTAACCTGAACTCGAGTTCAGGTTAGAGATTCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009326.2-940s21c1
Sequence:CCGGGCCCATGACTACCTATGTTGTCTCGAGACAACATAGGTAGTCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009326.2-715s21c1
Sequence:CCGGGAATGTGTTGTGTGGTGCCATCTCGAGATGGCACCACACAACACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009326.2-192s21c1
Sequence:CCGGAGCTGAAGAATATGCCTATTACTCGAGTAATAGGCATATTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009326
VALIDATED
TCEA2 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII), 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009326.1-236s1c1
Sequence:CCGGCGTGTTGGGATGTCTGTCAATCTCGAGATTGACAGACATCCCAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009326.1-940s1c1
Sequence:CCGGGCCCATGACTACCTATGTTGTCTCGAGACAACATAGGTAGTCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009326.1-667s1c1
Sequence:CCGGGAGCCGAATCTCTAACCTGAACTCGAGTTCAGGTTAGAGATTCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009326.1-715s1c1
Sequence:CCGGGAATGTGTTGTGTGGTGCCATCTCGAGATGGCACCACACAACACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009326.1-191s1c1
Sequence:CCGGGAGCTGAAGAATATGCCTATTCTCGAGAATAGGCATATTCTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009326.2-521s21c1
Sequence:CCGGTGCCGAGAGATGCTGACTTTGCTCGAGCAAAGTCAGCATCTCTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009326.2-667s21c1
Sequence:CCGGGAGCCGAATCTCTAACCTGAACTCGAGTTCAGGTTAGAGATTCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009326.2-940s21c1
Sequence:CCGGGCCCATGACTACCTATGTTGTCTCGAGACAACATAGGTAGTCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009326.2-715s21c1
Sequence:CCGGGAATGTGTTGTGTGGTGCCATCTCGAGATGGCACCACACAACACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009326.2-192s21c1
Sequence:CCGGAGCTGAAGAATATGCCTATTACTCGAGTAATAGGCATATTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009326
VALIDATED
TCEA2 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII), 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009326.1-236s1c1
Sequence:CCGGCGTGTTGGGATGTCTGTCAATCTCGAGATTGACAGACATCCCAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009326.1-940s1c1
Sequence:CCGGGCCCATGACTACCTATGTTGTCTCGAGACAACATAGGTAGTCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009326.1-667s1c1
Sequence:CCGGGAGCCGAATCTCTAACCTGAACTCGAGTTCAGGTTAGAGATTCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009326.1-715s1c1
Sequence:CCGGGAATGTGTTGTGTGGTGCCATCTCGAGATGGCACCACACAACACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009326.1-191s1c1
Sequence:CCGGGAGCTGAAGAATATGCCTATTCTCGAGAATAGGCATATTCTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009326.2-521s21c1
Sequence:CCGGTGCCGAGAGATGCTGACTTTGCTCGAGCAAAGTCAGCATCTCTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009326.2-667s21c1
Sequence:CCGGGAGCCGAATCTCTAACCTGAACTCGAGTTCAGGTTAGAGATTCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009326.2-940s21c1
Sequence:CCGGGCCCATGACTACCTATGTTGTCTCGAGACAACATAGGTAGTCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009326.2-715s21c1
Sequence:CCGGGAATGTGTTGTGTGGTGCCATCTCGAGATGGCACCACACAACACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009326.2-192s21c1
Sequence:CCGGAGCTGAAGAATATGCCTATTACTCGAGTAATAGGCATATTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks