EMAIL THIS PAGE TO A FRIEND

TCEA3

transcription elongation factor A (SII), 3

Synonyms: TFIIS TFIIS.H
UniProtKB ID: O75764, A8K2K7
Gene ID:
Mouse(21401) transcription elongation factor A (SII), 3
Rat(298559) transcription elongation factor A (SII), 3
domestic guinea pig(100722905) transcription elongation factor A (SII), 3
naked mole-rat(101710332) transcription elongation factor A (SII), 3
cow(533803) transcription elongation factor A (SII), 3
sheep(101121158) transcription elongation factor A (SII), 3
Zebrafish(402983) transcription elongation factor A (SII), 3
domestic cat(101097822) transcription elongation factor A (SII), 3
dog(478190) transcription elongation factor A (SII), 3
chicken(100858897) transcription elongation factor A (SII), 3
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV33409 Anti-TCEA3 (AB1) antibody produced in rabbit affinity isolated antibody mouse, rabbit, human, bovine, horse, canine
western blot pricing
AV33410 Anti-TCEA3 (AB2) antibody produced in rabbit affinity isolated antibody human, canine, guinea pig, horse, rabbit, bovine
western blot pricing
SAB1406511 Anti-TCEA3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1412136 ANTI-TCEA3 antibody produced in mouse clone 2C9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412137 ANTI-TCEA3 antibody produced in mouse clone 3G6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2102387 Anti-TCEA3 antibody produced in rabbit affinity isolated antibody bovine, human, rat, horse, canine, mouse
western blot pricing
HPA044960 Anti-TCEA3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106778 Anti-TCEA3 antibody produced in rabbit affinity isolated antibody guinea pig, human, horse, rabbit, mouse
ELISA, western blot pricing
HPA055811 Anti-TCEA3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0006920M7 Monoclonal Anti-TCEA3 antibody produced in mouse clone 3B9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404446 Monoclonal Anti-TCEA3 antibody produced in mouse clone 4E11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003196 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003196 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003196 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011542 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011542 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011542 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_114075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_114075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_114075 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003196 Rosetta Predictions human pricing
NM_001015008 Rosetta Predictions rat pricing
XM_001069071 Rosetta Predictions rat pricing
NM_011542 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032489 predicted 948
2 SASI_Hs01_00032490 predicted 633
3 SASI_Hs01_00032491 predicted 1153
4 SASI_Hs01_00032492 predicted 735
5 SASI_Hs01_00032493 predicted 679
6 SASI_Hs01_00032494 predicted 1045
7 SASI_Hs01_00032495 predicted 1131
8 SASI_Hs02_00335234 predicted 1052
9 SASI_Hs01_00032496 predicted 927
10 SASI_Hs01_00032497 predicted 933
11 SASI_Hs01_00032498 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015008 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201951 predicted 632
2 SASI_Rn02_00201952 predicted 720
3 SASI_Rn02_00201953 predicted 738
4 SASI_Rn02_00201954 predicted 868
5 SASI_Rn02_00201955 predicted 679
6 SASI_Rn02_00201956 predicted 987
7 SASI_Rn02_00201957 predicted 926
8 SASI_Rn02_00201958 predicted 970
9 SASI_Rn02_00201959 predicted 922
10 SASI_Rn02_00201960 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326790 predicted 943
2 SASI_Rn02_00326791 predicted 646
3 SASI_Rn02_00326792 predicted 728
4 SASI_Rn02_00326793 predicted 745
5 SASI_Rn02_00326794 predicted 876
6 SASI_Rn02_00326795 predicted 688
7 SASI_Rn02_00326796 predicted 951
8 SASI_Rn02_00326797 predicted 935
9 SASI_Rn02_00326798 predicted 938
10 SASI_Rn02_00326799 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011542 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072790 predicted 910
2 SASI_Mm02_00320890 predicted 739
3 SASI_Mm01_00072791 predicted 630
4 SASI_Mm01_00072792 predicted 713
5 SASI_Mm01_00072793 predicted 955
6 SASI_Mm01_00072794 predicted 655
7 SASI_Mm01_00072795 predicted 922
8 SASI_Mm01_00072796 predicted 772
9 SASI_Mm01_00072797 predicted 695
10 SASI_Mm01_00072798 predicted 970
11 SASI_Mm01_00072799 predicted 732
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003196
TCEA3 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII), 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000318715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003196.1-924s21c1
Sequence:CCGGCGCAGGGCTTATAGCCAAGATCTCGAGATCTTGGCTATAAGCCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003196.1-1125s21c1
Sequence:CCGGGCCCATGACTACCTTTGTCTTCTCGAGAAGACAAAGGTAGTCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003196.1-251s21c1
Sequence:CCGGCCATCCAGCTACTACAGACAACTCGAGTTGTCTGTAGTAGCTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003196.1-739s21c1
Sequence:CCGGGACGATGATTACAAGGACTATCTCGAGATAGTCCTTGTAATCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003196
TCEA3 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII), 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000318715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003196.1-924s21c1
Sequence:CCGGCGCAGGGCTTATAGCCAAGATCTCGAGATCTTGGCTATAAGCCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003196.1-1125s21c1
Sequence:CCGGGCCCATGACTACCTTTGTCTTCTCGAGAAGACAAAGGTAGTCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003196.1-251s21c1
Sequence:CCGGCCATCCAGCTACTACAGACAACTCGAGTTGTCTGTAGTAGCTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003196.1-739s21c1
Sequence:CCGGGACGATGATTACAAGGACTATCTCGAGATAGTCCTTGTAATCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003196
TCEA3 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII), 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000318715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003196.1-924s21c1
Sequence:CCGGCGCAGGGCTTATAGCCAAGATCTCGAGATCTTGGCTATAAGCCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003196.1-1125s21c1
Sequence:CCGGGCCCATGACTACCTTTGTCTTCTCGAGAAGACAAAGGTAGTCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003196.1-251s21c1
Sequence:CCGGCCATCCAGCTACTACAGACAACTCGAGTTGTCTGTAGTAGCTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003196.1-739s21c1
Sequence:CCGGGACGATGATTACAAGGACTATCTCGAGATAGTCCTTGTAATCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011542
VALIDATED
TCEA3 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII), 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011542.1-178s21c1
Sequence:CCGGGAAGCTGAACAGTTGCCAGATCTCGAGATCTGGCAACTGTTCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011542.1-745s21c1
Sequence:CCGGCCATATCTATCAAGAACTCAACTCGAGTTGAGTTCTTGATAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011542.1-728s21c1
Sequence:CCGGGCCTCAGAAATAGAAGACCATCTCGAGATGGTCTTCTATTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011542.1-527s21c1
Sequence:CCGGTCCAACAGCAGCAAATCTAAACTCGAGTTTAGATTTGCTGCTGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011542.1-284s21c1
Sequence:CCGGTTGGCCAAAGTCCTCATTAAACTCGAGTTTAATGAGGACTTTGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011542.1-728s1c1
Sequence:CCGGGCCTCAGAAATAGAAGACCATCTCGAGATGGTCTTCTATTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011542.1-745s1c1
Sequence:CCGGCCATATCTATCAAGAACTCAACTCGAGTTGAGTTCTTGATAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011542.1-1006s1c1
Sequence:CCGGGCGGTGTAGCAAGTGCAAGAACTCGAGTTCTTGCACTTGCTACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011542.1-730s1c1
Sequence:CCGGCTCAGAAATAGAAGACCATATCTCGAGATATGGTCTTCTATTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011542.1-178s1c1
Sequence:CCGGGAAGCTGAACAGTTGCCAGATCTCGAGATCTGGCAACTGTTCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011542
VALIDATED
TCEA3 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII), 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011542.1-178s21c1
Sequence:CCGGGAAGCTGAACAGTTGCCAGATCTCGAGATCTGGCAACTGTTCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011542.1-745s21c1
Sequence:CCGGCCATATCTATCAAGAACTCAACTCGAGTTGAGTTCTTGATAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011542.1-728s21c1
Sequence:CCGGGCCTCAGAAATAGAAGACCATCTCGAGATGGTCTTCTATTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011542.1-527s21c1
Sequence:CCGGTCCAACAGCAGCAAATCTAAACTCGAGTTTAGATTTGCTGCTGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011542.1-284s21c1
Sequence:CCGGTTGGCCAAAGTCCTCATTAAACTCGAGTTTAATGAGGACTTTGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011542.1-728s1c1
Sequence:CCGGGCCTCAGAAATAGAAGACCATCTCGAGATGGTCTTCTATTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011542.1-745s1c1
Sequence:CCGGCCATATCTATCAAGAACTCAACTCGAGTTGAGTTCTTGATAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011542.1-1006s1c1
Sequence:CCGGGCGGTGTAGCAAGTGCAAGAACTCGAGTTCTTGCACTTGCTACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011542.1-730s1c1
Sequence:CCGGCTCAGAAATAGAAGACCATATCTCGAGATATGGTCTTCTATTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011542.1-178s1c1
Sequence:CCGGGAAGCTGAACAGTTGCCAGATCTCGAGATCTGGCAACTGTTCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011542
VALIDATED
TCEA3 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII), 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011542.1-178s21c1
Sequence:CCGGGAAGCTGAACAGTTGCCAGATCTCGAGATCTGGCAACTGTTCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011542.1-745s21c1
Sequence:CCGGCCATATCTATCAAGAACTCAACTCGAGTTGAGTTCTTGATAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011542.1-728s21c1
Sequence:CCGGGCCTCAGAAATAGAAGACCATCTCGAGATGGTCTTCTATTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011542.1-527s21c1
Sequence:CCGGTCCAACAGCAGCAAATCTAAACTCGAGTTTAGATTTGCTGCTGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011542.1-284s21c1
Sequence:CCGGTTGGCCAAAGTCCTCATTAAACTCGAGTTTAATGAGGACTTTGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011542.1-728s1c1
Sequence:CCGGGCCTCAGAAATAGAAGACCATCTCGAGATGGTCTTCTATTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011542.1-745s1c1
Sequence:CCGGCCATATCTATCAAGAACTCAACTCGAGTTGAGTTCTTGATAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011542.1-1006s1c1
Sequence:CCGGGCGGTGTAGCAAGTGCAAGAACTCGAGTTCTTGCACTTGCTACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011542.1-730s1c1
Sequence:CCGGCTCAGAAATAGAAGACCATATCTCGAGATATGGTCTTCTATTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011542.1-178s1c1
Sequence:CCGGGAAGCTGAACAGTTGCCAGATCTCGAGATCTGGCAACTGTTCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_114075
TCEA3 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII), 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114075.4-223s1c1
Sequence:CCGGCCATCCAGCTACTACAGACAACTCGAGTTGTCTGTAGTAGCTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114075.4-896s1c1
Sequence:CCGGCGCAGGGCTTATAGCCAAGATCTCGAGATCTTGGCTATAAGCCCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114075.4-711s1c1
Sequence:CCGGGACGATGATTACAAGGACTATCTCGAGATAGTCCTTGTAATCATCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114075.4-1097s1c1
Sequence:CCGGGCCCATGACTACCTTTGTCTTCTCGAGAAGACAAAGGTAGTCATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114075.4-413s1c1
Sequence:CCGGGCTTGAGTGTTCAGACTGGAACTCGAGTTCCAGTCTGAACACTCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_114075
TCEA3 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII), 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114075.4-223s1c1
Sequence:CCGGCCATCCAGCTACTACAGACAACTCGAGTTGTCTGTAGTAGCTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114075.4-896s1c1
Sequence:CCGGCGCAGGGCTTATAGCCAAGATCTCGAGATCTTGGCTATAAGCCCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114075.4-711s1c1
Sequence:CCGGGACGATGATTACAAGGACTATCTCGAGATAGTCCTTGTAATCATCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114075.4-1097s1c1
Sequence:CCGGGCCCATGACTACCTTTGTCTTCTCGAGAAGACAAAGGTAGTCATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114075.4-413s1c1
Sequence:CCGGGCTTGAGTGTTCAGACTGGAACTCGAGTTCCAGTCTGAACACTCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_114075
TCEA3 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII), 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114075.4-223s1c1
Sequence:CCGGCCATCCAGCTACTACAGACAACTCGAGTTGTCTGTAGTAGCTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114075.4-896s1c1
Sequence:CCGGCGCAGGGCTTATAGCCAAGATCTCGAGATCTTGGCTATAAGCCCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114075.4-711s1c1
Sequence:CCGGGACGATGATTACAAGGACTATCTCGAGATAGTCCTTGTAATCATCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114075.4-1097s1c1
Sequence:CCGGGCCCATGACTACCTTTGTCTTCTCGAGAAGACAAAGGTAGTCATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114075.4-413s1c1
Sequence:CCGGGCTTGAGTGTTCAGACTGGAACTCGAGTTCCAGTCTGAACACTCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks