EMAIL THIS PAGE TO A FRIEND

TCEAL1

transcription elongation factor A (SII)-like 1

Synonyms: SIIR p21 pp21
UniProtKB ID: Q15170, Q9UJQ9
Gene ID:
Human(9338) Summary: This gene encodes a member of the transcription elongation factor A (SII)-like (TCEAL) gene family. Members of this family may function as nuclear phosphoproteins that modulate transcription in a promoter context-dependent manner. The encoded protein is similar to transcription elongation factor A/transcription factor SII and contains a zinc finger-like motif as well as a sequence related to the transcription factor SII Pol II-binding region. It may exert its effects via protein-protein interactions with other transcriptional regulators rather than via direct binding of DNA. Multiple family members are located on the X chromosome. Alternative splicing results in multiple transcript variants encoding a single isoform. [provided by RefSeq, Jul 2008]
Mouse(237052) transcription elongation factor A (SII)-like 1
Rat(302593) transcription elongation factor A (SII)-like 1
dog(481000) transcription elongation factor A (SII)-like 1
domestic cat(101096793) transcription elongation factor A (SII)-like 1
cow(507187) transcription elongation factor A (SII)-like 1
sheep(101119618) transcription elongation factor A (SII)-like 1
domestic guinea pig(101788496) transcription elongation factor A (SII)-like 1
121 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004780 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004780 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004780 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146236 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146236 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146236 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006639 Rosetta Predictions human pricing
NM_001006640 Rosetta Predictions human pricing
NM_004780 Rosetta Predictions human pricing
NM_001009675 Rosetta Predictions rat pricing
NM_146236 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191552 predicted 527
2 SASI_Hs01_00191554 predicted 476
3 SASI_Hs01_00191555 predicted 514
4 SASI_Hs01_00191546 predicted 334
5 SASI_Hs02_00305105 predicted 513
6 SASI_Hs02_00305106 predicted 423
7 SASI_Hs01_00191547 predicted 367
8 SASI_Hs02_00305107 predicted 449
9 SASI_Hs02_00305108 predicted 478
10 SASI_Hs02_00305109 predicted 588
11 SASI_Hs01_00191548 predicted 360
12 SASI_Hs01_00191549 predicted 358
13 SASI_Hs01_00191550 predicted 369
14 SASI_Hs01_00191551 predicted 364
15 SASI_Hs01_00191553 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068491 predicted 532
2 SASI_Hs01_00068493 predicted 491
3 SASI_Hs01_00068494 predicted 523
4 SASI_Hs01_00068485 predicted 349
5 SASI_Hs02_00305110 predicted 526
6 SASI_Hs02_00305111 predicted 429
7 SASI_Hs01_00068486 predicted 387
8 SASI_Hs02_00305112 predicted 462
9 SASI_Hs02_00305113 predicted 490
10 SASI_Hs02_00305114 predicted 595
11 SASI_Hs01_00068487 predicted 377
12 SASI_Hs01_00068488 predicted 379
13 SASI_Hs01_00068489 predicted 382
14 SASI_Hs01_00068490 predicted 384
15 SASI_Hs01_00068492 predicted 1156
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201260 predicted 341
2 SASI_Hs02_00338286 predicted 382
3 SASI_Hs02_00338287 predicted 373
4 SASI_Hs02_00338288 predicted 372
5 SASI_Hs02_00338289 predicted 372
6 SASI_Hs02_00338290 predicted 371
7 SASI_Hs01_00201257 predicted 537
8 SASI_Hs02_00338291 predicted 1145
9 SASI_Hs01_00201258 predicted 495
10 SASI_Hs01_00201259 predicted 527
11 SASI_Hs01_00201261 predicted 531
12 SASI_Hs01_00201262 predicted 441
13 SASI_Hs01_00201263 predicted 461
14 SASI_Hs01_00201264 predicted 497
15 SASI_Hs01_00201265 predicted 606
16 SASI_Hs01_00201266 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121943 predicted 574
2 SASI_Rn01_00121944 predicted 676
3 SASI_Rn01_00121945 predicted 216
4 SASI_Rn01_00121946 predicted 703
5 SASI_Rn01_00121947 predicted 482
6 SASI_Rn01_00121948 predicted 829
7 SASI_Rn02_00199713 predicted 495
8 SASI_Rn01_00121949 predicted 574
9 SASI_Rn02_00199714 predicted 703
10 SASI_Rn01_00121950 predicted 557
11 SASI_Rn01_00121942 predicted 825
12 SASI_Rn01_00121951 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146236 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030170 predicted 386
2 SASI_Mm01_00030173 predicted 474
3 SASI_Mm02_00341944 predicted 411
4 SASI_Mm01_00030175 predicted 417
5 SASI_Mm01_00030176 predicted 382
6 SASI_Mm01_00030177 predicted 424
7 SASI_Mm01_00030178 predicted 388
8 SASI_Mm01_00030179 predicted 397
9 SASI_Mm02_00341945 predicted 476
10 SASI_Mm02_00341946 predicted 289
11 SASI_Mm01_00030171 predicted 354
12 SASI_Mm01_00030172 predicted 354
13 SASI_Mm01_00030174 predicted 246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004780
VALIDATED
TCEAL1 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII)-like 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004780.1-840s1c1
Sequence:CCGGGCCCTACACATTTGCATGAAACTCGAGTTTCATGCAAATGTGTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004780.1-552s1c1
Sequence:CCGGGATGAGCTAGAAGAGATGAAACTCGAGTTTCATCTCTTCTAGCTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004780.1-233s1c1
Sequence:CCGGCCGGTGGAGCACTCTCCCGAACTCGAGTTCGGGAGAGTGCTCCACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004780.1-510s1c1
Sequence:CCGGCATGGCAGAAATTTAAGCAATCTCGAGATTGCTTAAATTTCTGCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004780.1-593s1c1
Sequence:CCGGGATAATGCACTGGAGGGCAAACTCGAGTTTGCCCTCCAGTGCATTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004780.2-633s21c1
Sequence:CCGGGAGCCGTCCTTATCCTATTTACTCGAGTAAATAGGATAAGGACGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004780.2-317s21c1
Sequence:CCGGTCTTTCCTGAGGAGCTCTTGCCTCGAGGCAAGAGCTCCTCAGGAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004780.2-435s21c1
Sequence:CCGGGCCTCCTTGTGGAGTAGGAAACTCGAGTTTCCTACTCCACAAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004780.2-543s21c1
Sequence:CCGGCAATGAGGAGATGATACAGGCCTCGAGGCCTGTATCATCTCCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004780.2-641s21c1
Sequence:CCGGCTTATCCTATTTAATGTGTTCCTCGAGGAACACATTAAATAGGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004780.2-649s21c1
Sequence:CCGGATTTAATGTGTTCGGCCTTTACTCGAGTAAAGGCCGAACACATTAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004780.2-595s21c1
Sequence:CCGGAGAAACAAACTGATGATAATGCTCGAGCATTATCATCAGTTTGTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004780
VALIDATED
TCEAL1 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII)-like 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004780.1-840s1c1
Sequence:CCGGGCCCTACACATTTGCATGAAACTCGAGTTTCATGCAAATGTGTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004780.1-552s1c1
Sequence:CCGGGATGAGCTAGAAGAGATGAAACTCGAGTTTCATCTCTTCTAGCTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004780.1-233s1c1
Sequence:CCGGCCGGTGGAGCACTCTCCCGAACTCGAGTTCGGGAGAGTGCTCCACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004780.1-510s1c1
Sequence:CCGGCATGGCAGAAATTTAAGCAATCTCGAGATTGCTTAAATTTCTGCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004780.1-593s1c1
Sequence:CCGGGATAATGCACTGGAGGGCAAACTCGAGTTTGCCCTCCAGTGCATTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004780.2-633s21c1
Sequence:CCGGGAGCCGTCCTTATCCTATTTACTCGAGTAAATAGGATAAGGACGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004780.2-317s21c1
Sequence:CCGGTCTTTCCTGAGGAGCTCTTGCCTCGAGGCAAGAGCTCCTCAGGAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004780.2-435s21c1
Sequence:CCGGGCCTCCTTGTGGAGTAGGAAACTCGAGTTTCCTACTCCACAAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004780.2-543s21c1
Sequence:CCGGCAATGAGGAGATGATACAGGCCTCGAGGCCTGTATCATCTCCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004780.2-641s21c1
Sequence:CCGGCTTATCCTATTTAATGTGTTCCTCGAGGAACACATTAAATAGGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004780.2-649s21c1
Sequence:CCGGATTTAATGTGTTCGGCCTTTACTCGAGTAAAGGCCGAACACATTAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004780.2-595s21c1
Sequence:CCGGAGAAACAAACTGATGATAATGCTCGAGCATTATCATCAGTTTGTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004780
VALIDATED
TCEAL1 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII)-like 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004780.1-840s1c1
Sequence:CCGGGCCCTACACATTTGCATGAAACTCGAGTTTCATGCAAATGTGTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004780.1-552s1c1
Sequence:CCGGGATGAGCTAGAAGAGATGAAACTCGAGTTTCATCTCTTCTAGCTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004780.1-233s1c1
Sequence:CCGGCCGGTGGAGCACTCTCCCGAACTCGAGTTCGGGAGAGTGCTCCACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004780.1-510s1c1
Sequence:CCGGCATGGCAGAAATTTAAGCAATCTCGAGATTGCTTAAATTTCTGCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004780.1-593s1c1
Sequence:CCGGGATAATGCACTGGAGGGCAAACTCGAGTTTGCCCTCCAGTGCATTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004780.2-633s21c1
Sequence:CCGGGAGCCGTCCTTATCCTATTTACTCGAGTAAATAGGATAAGGACGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004780.2-317s21c1
Sequence:CCGGTCTTTCCTGAGGAGCTCTTGCCTCGAGGCAAGAGCTCCTCAGGAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004780.2-435s21c1
Sequence:CCGGGCCTCCTTGTGGAGTAGGAAACTCGAGTTTCCTACTCCACAAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004780.2-543s21c1
Sequence:CCGGCAATGAGGAGATGATACAGGCCTCGAGGCCTGTATCATCTCCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004780.2-641s21c1
Sequence:CCGGCTTATCCTATTTAATGTGTTCCTCGAGGAACACATTAAATAGGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004780.2-649s21c1
Sequence:CCGGATTTAATGTGTTCGGCCTTTACTCGAGTAAAGGCCGAACACATTAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004780.2-595s21c1
Sequence:CCGGAGAAACAAACTGATGATAATGCTCGAGCATTATCATCAGTTTGTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146236
VALIDATED
TCEAL1 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII)-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146236.1-599s1c1
Sequence:CCGGCCCTTGTGTTTGCATCTTCTTCTCGAGAAGAAGATGCAAACACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146236.1-483s1c1
Sequence:CCGGGAGAGTACGAAACAAACTGATCTCGAGATCAGTTTGTTTCGTACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146236.1-400s1c1
Sequence:CCGGCCTCAATTCATAGGAGACATTCTCGAGAATGTCTCCTATGAATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146236.1-375s1c1
Sequence:CCGGCAAAGAAAGACTGGCCCGTATCTCGAGATACGGGCCAGTCTTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146236.1-399s1c1
Sequence:CCGGCCCTCAATTCATAGGAGACATCTCGAGATGTCTCCTATGAATTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146236.1-599s21c1
Sequence:CCGGCCCTTGTGTTTGCATCTTCTTCTCGAGAAGAAGATGCAAACACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146236.1-299s21c1
Sequence:CCGGACCAGTTCGAAGACCGTATTCCTCGAGGAATACGGTCTTCGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146236.1-147s21c1
Sequence:CCGGGTGCTCTGAGGAGGATCAATCCTCGAGGATTGATCCTCCTCAGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146236.1-392s21c1
Sequence:CCGGGTATCCGCCCTCAATTCATAGCTCGAGCTATGAATTGAGGGCGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146236.1-483s21c1
Sequence:CCGGGAGAGTACGAAACAAACTGATCTCGAGATCAGTTTGTTTCGTACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146236
VALIDATED
TCEAL1 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII)-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146236.1-599s1c1
Sequence:CCGGCCCTTGTGTTTGCATCTTCTTCTCGAGAAGAAGATGCAAACACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146236.1-483s1c1
Sequence:CCGGGAGAGTACGAAACAAACTGATCTCGAGATCAGTTTGTTTCGTACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146236.1-400s1c1
Sequence:CCGGCCTCAATTCATAGGAGACATTCTCGAGAATGTCTCCTATGAATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146236.1-375s1c1
Sequence:CCGGCAAAGAAAGACTGGCCCGTATCTCGAGATACGGGCCAGTCTTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146236.1-399s1c1
Sequence:CCGGCCCTCAATTCATAGGAGACATCTCGAGATGTCTCCTATGAATTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146236.1-599s21c1
Sequence:CCGGCCCTTGTGTTTGCATCTTCTTCTCGAGAAGAAGATGCAAACACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146236.1-299s21c1
Sequence:CCGGACCAGTTCGAAGACCGTATTCCTCGAGGAATACGGTCTTCGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146236.1-147s21c1
Sequence:CCGGGTGCTCTGAGGAGGATCAATCCTCGAGGATTGATCCTCCTCAGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146236.1-392s21c1
Sequence:CCGGGTATCCGCCCTCAATTCATAGCTCGAGCTATGAATTGAGGGCGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146236.1-483s21c1
Sequence:CCGGGAGAGTACGAAACAAACTGATCTCGAGATCAGTTTGTTTCGTACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146236
VALIDATED
TCEAL1 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII)-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146236.1-599s1c1
Sequence:CCGGCCCTTGTGTTTGCATCTTCTTCTCGAGAAGAAGATGCAAACACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146236.1-483s1c1
Sequence:CCGGGAGAGTACGAAACAAACTGATCTCGAGATCAGTTTGTTTCGTACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146236.1-400s1c1
Sequence:CCGGCCTCAATTCATAGGAGACATTCTCGAGAATGTCTCCTATGAATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146236.1-375s1c1
Sequence:CCGGCAAAGAAAGACTGGCCCGTATCTCGAGATACGGGCCAGTCTTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146236.1-399s1c1
Sequence:CCGGCCCTCAATTCATAGGAGACATCTCGAGATGTCTCCTATGAATTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146236.1-599s21c1
Sequence:CCGGCCCTTGTGTTTGCATCTTCTTCTCGAGAAGAAGATGCAAACACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146236.1-299s21c1
Sequence:CCGGACCAGTTCGAAGACCGTATTCCTCGAGGAATACGGTCTTCGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146236.1-147s21c1
Sequence:CCGGGTGCTCTGAGGAGGATCAATCCTCGAGGATTGATCCTCCTCAGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146236.1-392s21c1
Sequence:CCGGGTATCCGCCCTCAATTCATAGCTCGAGCTATGAATTGAGGGCGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146236.1-483s21c1
Sequence:CCGGGAGAGTACGAAACAAACTGATCTCGAGATCAGTTTGTTTCGTACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks