EMAIL THIS PAGE TO A FRIEND

TCEAL2

transcription elongation factor A (SII)-like 2

Synonyms: MY0876G05 my048
Species: Human TCEAL2(140597)
UniProtKB ID: Q9H3H9, B2R5C7
Gene ID:
Human(140597) Summary: This gene encodes a member of the transcription elongation factor A (SII)-like (TCEAL) gene family. Members of this family contain TFA domains and may function as nuclear phosphoproteins that modulate transcription in a promoter context-dependent manner. Multiple family members are located on the X chromosome. [provided by RefSeq, Jul 2008]
33 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080390 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080390 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080390 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018591 MISSION® esiRNA esiRNA targeting human TCEAL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080390 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362224 predicted 669
2 SASI_Hs02_00362225 predicted 912
3 SASI_Hs02_00362226 predicted 1014
4 SASI_Hs02_00362227 predicted 970
5 SASI_Hs02_00362228 predicted 996
6 SASI_Hs02_00362229 predicted 908
7 SASI_Hs02_00362230 predicted 1006
8 SASI_Hs02_00362231 predicted 964
9 SASI_Hs02_00362232 predicted 264
10 SASI_Hs02_00362233 predicted 998
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080390
TCEAL2 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII)-like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080390.3-306s21c1
Sequence:CCGGGCCAGAAGTAGCTTGTATTCTCTCGAGAGAATACAAGCTACTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080390.3-616s21c1
Sequence:CCGGGATATACCCAGGAAAGCCAAACTCGAGTTTGGCTTTCCTGGGTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080390.3-952s21c1
Sequence:CCGGTACTTTGCTTTAGTCGTTCCTCTCGAGAGGAACGACTAAAGCAAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080390.2-317s1c1
Sequence:CCGGCAAGAGAGTTGAGGAACCGTTCTCGAGAACGGTTCCTCAACTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080390.2-816s1c1
Sequence:CCGGCGAAGGGACACTGAAGACATTCTCGAGAATGTCTTCAGTGTCCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080390.2-197s1c1
Sequence:CCGGGCCTTCGAATCAAGGAAAGATCTCGAGATCTTTCCTTGATTCGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080390.2-627s1c1
Sequence:CCGGGAAGCCATACATGATATGAATCTCGAGATTCATATCATGTATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080390.2-330s1c1
Sequence:CCGGGAACCGTTAAAGGATAAAGAACTCGAGTTCTTTATCCTTTAACGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080390.2-203s1c1
Sequence:CCGGGAATCAAGGAAAGATAGACAACTCGAGTTGTCTATCTTTCCTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080390
TCEAL2 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII)-like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080390.3-306s21c1
Sequence:CCGGGCCAGAAGTAGCTTGTATTCTCTCGAGAGAATACAAGCTACTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080390.3-616s21c1
Sequence:CCGGGATATACCCAGGAAAGCCAAACTCGAGTTTGGCTTTCCTGGGTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080390.3-952s21c1
Sequence:CCGGTACTTTGCTTTAGTCGTTCCTCTCGAGAGGAACGACTAAAGCAAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080390.2-317s1c1
Sequence:CCGGCAAGAGAGTTGAGGAACCGTTCTCGAGAACGGTTCCTCAACTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080390.2-816s1c1
Sequence:CCGGCGAAGGGACACTGAAGACATTCTCGAGAATGTCTTCAGTGTCCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080390.2-197s1c1
Sequence:CCGGGCCTTCGAATCAAGGAAAGATCTCGAGATCTTTCCTTGATTCGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080390.2-627s1c1
Sequence:CCGGGAAGCCATACATGATATGAATCTCGAGATTCATATCATGTATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080390.2-330s1c1
Sequence:CCGGGAACCGTTAAAGGATAAAGAACTCGAGTTCTTTATCCTTTAACGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080390.2-203s1c1
Sequence:CCGGGAATCAAGGAAAGATAGACAACTCGAGTTGTCTATCTTTCCTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080390
TCEAL2 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII)-like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080390.3-306s21c1
Sequence:CCGGGCCAGAAGTAGCTTGTATTCTCTCGAGAGAATACAAGCTACTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080390.3-616s21c1
Sequence:CCGGGATATACCCAGGAAAGCCAAACTCGAGTTTGGCTTTCCTGGGTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080390.3-952s21c1
Sequence:CCGGTACTTTGCTTTAGTCGTTCCTCTCGAGAGGAACGACTAAAGCAAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080390.2-317s1c1
Sequence:CCGGCAAGAGAGTTGAGGAACCGTTCTCGAGAACGGTTCCTCAACTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080390.2-816s1c1
Sequence:CCGGCGAAGGGACACTGAAGACATTCTCGAGAATGTCTTCAGTGTCCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080390.2-197s1c1
Sequence:CCGGGCCTTCGAATCAAGGAAAGATCTCGAGATCTTTCCTTGATTCGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080390.2-627s1c1
Sequence:CCGGGAAGCCATACATGATATGAATCTCGAGATTCATATCATGTATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080390.2-330s1c1
Sequence:CCGGGAACCGTTAAAGGATAAAGAACTCGAGTTCTTTATCCTTTAACGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080390.2-203s1c1
Sequence:CCGGGAATCAAGGAAAGATAGACAACTCGAGTTGTCTATCTTTCCTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks