EMAIL THIS PAGE TO A FRIEND

TCEAL3

transcription elongation factor A (SII)-like 3

UniProtKB ID: Q969E4, D3DXA4
Gene ID:
Human(85012) Summary: This gene encodes a member of the transcription elongation factor A (SII)-like (TCEAL) gene family. Members of this family contain TFA domains and may function as nuclear phosphoproteins that modulate transcription in a promoter context-dependent manner. Multiple family members are located on the X chromosome. Alternative splicing results in multiple transcript variants encoding a single isoform. [provided by RefSeq, Jul 2008]
Mouse(594844) transcription elongation factor A (SII)-like 3
Rat(501628) transcription elongation factor A (SII)-like 3
domestic cat(101081708) transcription elongation factor A (SII)-like 3
dog(492034) transcription elongation factor A (SII)-like 3
domestic guinea pig(100714488) transcription elongation factor A (SII)-like 3
naked mole-rat(101701165) transcription elongation factor A (SII)-like 3
cow(101902451) transcription elongation factor A (SII)-like 3
sheep(101117654) transcription elongation factor A (SII)-like 3
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029978 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001029978 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001029978 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032926 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032926 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032926 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111211 MISSION® esiRNA esiRNA human TCEAL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006933 Rosetta Predictions human pricing
NM_032926 Rosetta Predictions human pricing
XM_001053346 Rosetta Predictions rat pricing
XM_001053421 Rosetta Predictions rat pricing
XM_577026 Rosetta Predictions rat pricing
NM_001029978 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126794 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063432 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272037 predicted 635
2 SASI_Rn02_00272038 predicted 872
3 SASI_Rn02_00272039 predicted 340
4 SASI_Rn02_00272040 predicted 874
5 SASI_Rn02_00272041 predicted 391
6 SASI_Rn02_00272042 predicted 785
7 SASI_Rn02_00272043 predicted 536
8 SASI_Rn02_00272044 predicted 653
9 SASI_Rn02_00272045 predicted 644
10 SASI_Rn02_00272046 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053421 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272279 predicted 587
2 SASI_Rn02_00272280 predicted 822
3 SASI_Rn02_00272281 predicted 288
4 SASI_Rn02_00272282 predicted 819
5 SASI_Rn02_00272283 predicted 341
6 SASI_Rn02_00272284 predicted 733
7 SASI_Rn02_00272285 predicted 491
8 SASI_Rn02_00272286 predicted 605
9 SASI_Rn02_00272287 predicted 587
10 SASI_Rn02_00272288 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577026 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406074 predicted 645
2 SASI_Rn02_00406075 predicted 585
3 SASI_Rn02_00406076 predicted 817
4 SASI_Rn02_00406077 predicted 819
5 SASI_Rn02_00406078 predicted 735
6 SASI_Rn02_00406079 predicted 609
7 SASI_Rn02_00406080 predicted 585
8 SASI_Rn02_00406081 predicted 837
9 SASI_Rn02_00406082 predicted 637
10 SASI_Rn02_00406083 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029978 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075006 predicted 370
2 SASI_Mm01_00075005 predicted 843
3 SASI_Mm02_00288074 predicted 659
4 SASI_Mm02_00288075 predicted 851
5 SASI_Mm01_00075008 predicted 434
6 SASI_Mm01_00075009 predicted 762
7 SASI_Mm02_00288076 predicted 660
8 SASI_Mm01_00075010 predicted 522
9 SASI_Mm01_00075011 predicted 637
10 SASI_Mm01_00075012 predicted 622
11 SASI_Mm01_00075007 predicted 790
12 SASI_Mm01_00075013 predicted 574
13 SASI_Mm01_00075014 predicted 778
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029978
TCEAL3 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII)-like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029978.1-691s1c1
Sequence:CCGGCAAGAGATGCACAGGATGCTTCTCGAGAAGCATCCTGTGCATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029978.1-882s1c1
Sequence:CCGGCTGTGCTTTAACCTTCAGCCACTCGAGTGGCTGAAGGTTAAAGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029978.1-854s1c1
Sequence:CCGGCGCTTTCCCTGGTAGATACTTCTCGAGAAGTATCTACCAGGGAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029978.1-255s1c1
Sequence:CCGGGATGAAGTAGAGCCTGAAGATCTCGAGATCTTCAGGCTCTACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029978.1-627s1c1
Sequence:CCGGGATATGACTAGGGCTCAGGAACTCGAGTTCCTGAGCCCTAGTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029978
TCEAL3 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII)-like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029978.1-691s1c1
Sequence:CCGGCAAGAGATGCACAGGATGCTTCTCGAGAAGCATCCTGTGCATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029978.1-882s1c1
Sequence:CCGGCTGTGCTTTAACCTTCAGCCACTCGAGTGGCTGAAGGTTAAAGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029978.1-854s1c1
Sequence:CCGGCGCTTTCCCTGGTAGATACTTCTCGAGAAGTATCTACCAGGGAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029978.1-255s1c1
Sequence:CCGGGATGAAGTAGAGCCTGAAGATCTCGAGATCTTCAGGCTCTACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029978.1-627s1c1
Sequence:CCGGGATATGACTAGGGCTCAGGAACTCGAGTTCCTGAGCCCTAGTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029978
TCEAL3 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII)-like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029978.1-691s1c1
Sequence:CCGGCAAGAGATGCACAGGATGCTTCTCGAGAAGCATCCTGTGCATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029978.1-882s1c1
Sequence:CCGGCTGTGCTTTAACCTTCAGCCACTCGAGTGGCTGAAGGTTAAAGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029978.1-854s1c1
Sequence:CCGGCGCTTTCCCTGGTAGATACTTCTCGAGAAGTATCTACCAGGGAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029978.1-255s1c1
Sequence:CCGGGATGAAGTAGAGCCTGAAGATCTCGAGATCTTCAGGCTCTACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029978.1-627s1c1
Sequence:CCGGGATATGACTAGGGCTCAGGAACTCGAGTTCCTGAGCCCTAGTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032926
TCEAL3 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII)-like 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032926.2-416s1c1
Sequence:CCGGGATGAGGGACAACTGGAAGATCTCGAGATCTTCCAGTTGTCCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032926.2-333s1c1
Sequence:CCGGGAAAGTCAGACGAGGAAGAAACTCGAGTTTCTTCCTCGTCTGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133930    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032926.2-943s1c1
Sequence:CCGGCCTTAAGCTGATACTTTGCTTCTCGAGAAGCAAAGTATCAGCTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032926.2-737s1c1
Sequence:CCGGCATTGGATGCAAAGAGATGTACTCGAGTACATCTCTTTGCATCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032926.2-320s1c1
Sequence:CCGGCCTGATGATGAAGGAAAGTCACTCGAGTGACTTTCCTTCATCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032926.2-672s1c1
Sequence:CCGGGAGAATGTGGAGATGTGTCAACTCGAGTTGACACATCTCCACATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032926.2-960s1c1
Sequence:CCGGGCTTTAGATGTCAGTCTCGTTCTCGAGAACGAGACTGACATCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032926.2-657s1c1
Sequence:CCGGGTGAGGAGATGATGAGAGAATCTCGAGATTCTCTCATCATCTCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032926.2-305s1c1
Sequence:CCGGGAAGATGAAGTAGAGCCTGATCTCGAGATCAGGCTCTACTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032926.2-746s1c1
Sequence:CCGGCAAAGAGATGTACAGGATCCACTCGAGTGGATCCTGTACATCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032926.2-629s1c1
Sequence:CCGGGAGGACTTACAGGAAAGGCATCTCGAGATGCCTTTCCTGTAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032926.2-308s1c1
Sequence:CCGGGATGAAGTAGAGCCTGATGATCTCGAGATCATCAGGCTCTACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032926.2-695s1c1
Sequence:CCGGGCTCAAGAGGAGCTAAGGAAACTCGAGTTTCCTTAGCTCCTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032926
TCEAL3 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII)-like 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032926.2-416s1c1
Sequence:CCGGGATGAGGGACAACTGGAAGATCTCGAGATCTTCCAGTTGTCCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032926.2-333s1c1
Sequence:CCGGGAAAGTCAGACGAGGAAGAAACTCGAGTTTCTTCCTCGTCTGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133930    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032926.2-943s1c1
Sequence:CCGGCCTTAAGCTGATACTTTGCTTCTCGAGAAGCAAAGTATCAGCTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032926.2-737s1c1
Sequence:CCGGCATTGGATGCAAAGAGATGTACTCGAGTACATCTCTTTGCATCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032926.2-320s1c1
Sequence:CCGGCCTGATGATGAAGGAAAGTCACTCGAGTGACTTTCCTTCATCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032926.2-672s1c1
Sequence:CCGGGAGAATGTGGAGATGTGTCAACTCGAGTTGACACATCTCCACATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032926.2-960s1c1
Sequence:CCGGGCTTTAGATGTCAGTCTCGTTCTCGAGAACGAGACTGACATCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032926.2-657s1c1
Sequence:CCGGGTGAGGAGATGATGAGAGAATCTCGAGATTCTCTCATCATCTCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032926.2-305s1c1
Sequence:CCGGGAAGATGAAGTAGAGCCTGATCTCGAGATCAGGCTCTACTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032926.2-746s1c1
Sequence:CCGGCAAAGAGATGTACAGGATCCACTCGAGTGGATCCTGTACATCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032926.2-629s1c1
Sequence:CCGGGAGGACTTACAGGAAAGGCATCTCGAGATGCCTTTCCTGTAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032926.2-308s1c1
Sequence:CCGGGATGAAGTAGAGCCTGATGATCTCGAGATCATCAGGCTCTACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032926.2-695s1c1
Sequence:CCGGGCTCAAGAGGAGCTAAGGAAACTCGAGTTTCCTTAGCTCCTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032926
TCEAL3 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII)-like 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032926.2-416s1c1
Sequence:CCGGGATGAGGGACAACTGGAAGATCTCGAGATCTTCCAGTTGTCCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032926.2-333s1c1
Sequence:CCGGGAAAGTCAGACGAGGAAGAAACTCGAGTTTCTTCCTCGTCTGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133930    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032926.2-943s1c1
Sequence:CCGGCCTTAAGCTGATACTTTGCTTCTCGAGAAGCAAAGTATCAGCTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032926.2-737s1c1
Sequence:CCGGCATTGGATGCAAAGAGATGTACTCGAGTACATCTCTTTGCATCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032926.2-320s1c1
Sequence:CCGGCCTGATGATGAAGGAAAGTCACTCGAGTGACTTTCCTTCATCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032926.2-672s1c1
Sequence:CCGGGAGAATGTGGAGATGTGTCAACTCGAGTTGACACATCTCCACATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032926.2-960s1c1
Sequence:CCGGGCTTTAGATGTCAGTCTCGTTCTCGAGAACGAGACTGACATCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032926.2-657s1c1
Sequence:CCGGGTGAGGAGATGATGAGAGAATCTCGAGATTCTCTCATCATCTCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032926.2-305s1c1
Sequence:CCGGGAAGATGAAGTAGAGCCTGATCTCGAGATCAGGCTCTACTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032926.2-746s1c1
Sequence:CCGGCAAAGAGATGTACAGGATCCACTCGAGTGGATCCTGTACATCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032926.2-629s1c1
Sequence:CCGGGAGGACTTACAGGAAAGGCATCTCGAGATGCCTTTCCTGTAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032926.2-308s1c1
Sequence:CCGGGATGAAGTAGAGCCTGATGATCTCGAGATCATCAGGCTCTACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032926.2-695s1c1
Sequence:CCGGGCTCAAGAGGAGCTAAGGAAACTCGAGTTTCCTTAGCTCCTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks