EMAIL THIS PAGE TO A FRIEND

TCEAL4

transcription elongation factor A (SII)-like 4

Synonyms: NPD017
UniProtKB ID: Q96EI5, Q8WY12, Q9H2H1, Q9H775
Gene ID:
Human(79921) Summary: This gene encodes a member of the transcription elongation factor A (SII)-like (TCEAL) gene family. Members of this family contain TFA domains and may function as nuclear phosphoproteins that modulate transcription in a promoter context-dependent manner. Multiple family members are located on the X chromosome. Alternative splicing occurs for this gene; however, the full-length nature of all transcript variants has not yet been described. [provided by RefSeq, Jul 2008]
domestic cat(101096548) transcription elongation factor A (SII)-like 4
dog(100682778) transcription elongation factor A (SII)-like 4
cow(513987) transcription elongation factor A (SII)-like 4
sheep(101119372) transcription elongation factor A (SII)-like 4
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1400709 Anti-TCEAL4 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB2102389 Anti-TCEAL4 antibody produced in rabbit affinity isolated antibody guinea pig, canine, mouse, rat, human, horse, rabbit
western blot pricing
SAB4300785 Anti-TCEAL4 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024863 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024863 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024863 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109051 MISSION® esiRNA esiRNA human TCEAL4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006935 Rosetta Predictions human pricing
NM_001006936 Rosetta Predictions human pricing
NM_001006937 Rosetta Predictions human pricing
NM_024863 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075882 predicted 910
2 SASI_Hs01_00075883 predicted 631
3 SASI_Hs01_00075890 predicted 978
4 SASI_Hs01_00075884 predicted 644
5 SASI_Hs01_00075886 predicted 913
6 SASI_Hs01_00075887 predicted 946
7 SASI_Hs01_00075889 predicted 946
8 SASI_Hs01_00075885 predicted 720
9 SASI_Hs01_00075888 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187806 predicted 905
2 SASI_Hs01_00187807 predicted 630
3 SASI_Hs01_00187814 predicted 977
4 SASI_Hs01_00187808 predicted 644
5 SASI_Hs01_00187810 predicted 913
6 SASI_Hs01_00187811 predicted 947
7 SASI_Hs01_00187813 predicted 949
8 SASI_Hs01_00187809 predicted 717
9 SASI_Hs01_00187812 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305137 predicted 899
2 SASI_Hs02_00305138 predicted 629
3 SASI_Hs02_00305139 predicted 973
4 SASI_Hs02_00305140 predicted 644
5 SASI_Hs02_00305141 predicted 913
6 SASI_Hs02_00305142 predicted 936
7 SASI_Hs02_00305143 predicted 939
8 SASI_Hs02_00305144 predicted 712
9 SASI_Hs02_00305145 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043800 predicted 968
2 SASI_Hs01_00043801 predicted 691
3 SASI_Hs01_00043808 predicted 1034
4 SASI_Hs01_00043802 predicted 708
5 SASI_Hs01_00043804 predicted 970
6 SASI_Hs01_00043805 predicted 1001
7 SASI_Hs01_00043807 predicted 1008
8 SASI_Hs01_00043803 predicted 777
9 SASI_Hs01_00043806 predicted 773
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024863
VALIDATED
TCEAL4 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII)-like 4
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024863.3-384s1c1
Sequence:CCGGCGGGACATAACAACTTCGGAACTCGAGTTCCGAAGTTGTTATGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_024863.3-1023s1c1
Sequence:CCGGGAGGATGATGTACCCAGGAAACTCGAGTTTCCTGGGTACATCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_024863.3-322s1c1
Sequence:CCGGGAAGAGACAAAGTCCACATCTCTCGAGAGATGTGGACTTTGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024863.3-1082s1c1
Sequence:CCGGCAAGGAGTATAAAGAGGCCATCTCGAGATGGCCTCTTTATACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168796    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024863.3-1071s1c1
Sequence:CCGGGCTCATTACCTCAAGGAGTATCTCGAGATACTCCTTGAGGTAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167970    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024863.3-1284s1c1
Sequence:CCGGCGAAGGGACATTGAAGACATTCTCGAGAATGTCTTCAATGTCCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024863.3-831s1c1
Sequence:CCGGGATGAGGAAATGTTAAAGGATCTCGAGATCCTTTAACATTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024863.3-1086s1c1
Sequence:CCGGGAGTATAAAGAGGCCATACATCTCGAGATGTATGGCCTCTTTATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024863.4-356s21c1
Sequence:CCGGAGAACAGCCACAAGACGAGAGCTCGAGCTCTCGTCTTGTGGCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024863.4-327s21c1
Sequence:CCGGGCTTCAAACCAAGGAAAGATGCTCGAGCATCTTTCCTTGGTTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024863.4-387s21c1
Sequence:CCCGGTAACTTGTACTCTGGAAGACCTCGAGGTCTTCCAGAGTACAAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024863.4-971s21c1
Sequence:CCGGTGCTTTAACGTTACGGTAATACTCGAGTATTACCGTAACGTTAAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024863.4-1046s21c1
Sequence:CCGGCAGTGTTCTCAGTAGGAAATGCTCGAGCATTTCCTACTGAGAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024863.4-1168s21c1
Sequence:CCGCCAAAGATACTTACCTAGTAATCTCGAGATTACTAGGTAAGTATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024863
VALIDATED
TCEAL4 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII)-like 4
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024863.3-384s1c1
Sequence:CCGGCGGGACATAACAACTTCGGAACTCGAGTTCCGAAGTTGTTATGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_024863.3-1023s1c1
Sequence:CCGGGAGGATGATGTACCCAGGAAACTCGAGTTTCCTGGGTACATCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_024863.3-322s1c1
Sequence:CCGGGAAGAGACAAAGTCCACATCTCTCGAGAGATGTGGACTTTGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024863.3-1082s1c1
Sequence:CCGGCAAGGAGTATAAAGAGGCCATCTCGAGATGGCCTCTTTATACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168796    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024863.3-1071s1c1
Sequence:CCGGGCTCATTACCTCAAGGAGTATCTCGAGATACTCCTTGAGGTAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167970    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024863.3-1284s1c1
Sequence:CCGGCGAAGGGACATTGAAGACATTCTCGAGAATGTCTTCAATGTCCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024863.3-831s1c1
Sequence:CCGGGATGAGGAAATGTTAAAGGATCTCGAGATCCTTTAACATTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024863.3-1086s1c1
Sequence:CCGGGAGTATAAAGAGGCCATACATCTCGAGATGTATGGCCTCTTTATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024863.4-356s21c1
Sequence:CCGGAGAACAGCCACAAGACGAGAGCTCGAGCTCTCGTCTTGTGGCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024863.4-327s21c1
Sequence:CCGGGCTTCAAACCAAGGAAAGATGCTCGAGCATCTTTCCTTGGTTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024863.4-387s21c1
Sequence:CCCGGTAACTTGTACTCTGGAAGACCTCGAGGTCTTCCAGAGTACAAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024863.4-971s21c1
Sequence:CCGGTGCTTTAACGTTACGGTAATACTCGAGTATTACCGTAACGTTAAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024863.4-1046s21c1
Sequence:CCGGCAGTGTTCTCAGTAGGAAATGCTCGAGCATTTCCTACTGAGAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024863.4-1168s21c1
Sequence:CCGCCAAAGATACTTACCTAGTAATCTCGAGATTACTAGGTAAGTATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024863
VALIDATED
TCEAL4 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII)-like 4
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024863.3-384s1c1
Sequence:CCGGCGGGACATAACAACTTCGGAACTCGAGTTCCGAAGTTGTTATGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_024863.3-1023s1c1
Sequence:CCGGGAGGATGATGTACCCAGGAAACTCGAGTTTCCTGGGTACATCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_024863.3-322s1c1
Sequence:CCGGGAAGAGACAAAGTCCACATCTCTCGAGAGATGTGGACTTTGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024863.3-1082s1c1
Sequence:CCGGCAAGGAGTATAAAGAGGCCATCTCGAGATGGCCTCTTTATACTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168796    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024863.3-1071s1c1
Sequence:CCGGGCTCATTACCTCAAGGAGTATCTCGAGATACTCCTTGAGGTAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167970    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024863.3-1284s1c1
Sequence:CCGGCGAAGGGACATTGAAGACATTCTCGAGAATGTCTTCAATGTCCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024863.3-831s1c1
Sequence:CCGGGATGAGGAAATGTTAAAGGATCTCGAGATCCTTTAACATTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024863.3-1086s1c1
Sequence:CCGGGAGTATAAAGAGGCCATACATCTCGAGATGTATGGCCTCTTTATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024863.4-356s21c1
Sequence:CCGGAGAACAGCCACAAGACGAGAGCTCGAGCTCTCGTCTTGTGGCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024863.4-327s21c1
Sequence:CCGGGCTTCAAACCAAGGAAAGATGCTCGAGCATCTTTCCTTGGTTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024863.4-387s21c1
Sequence:CCCGGTAACTTGTACTCTGGAAGACCTCGAGGTCTTCCAGAGTACAAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024863.4-971s21c1
Sequence:CCGGTGCTTTAACGTTACGGTAATACTCGAGTATTACCGTAACGTTAAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024863.4-1046s21c1
Sequence:CCGGCAGTGTTCTCAGTAGGAAATGCTCGAGCATTTCCTACTGAGAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024863.4-1168s21c1
Sequence:CCGCCAAAGATACTTACCTAGTAATCTCGAGATTACTAGGTAAGTATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks