EMAIL THIS PAGE TO A FRIEND

TCEAL6

transcription elongation factor A (SII)-like 6

Synonyms: Tceal3
UniProtKB ID: Q6IPX3, Q5H9J8
Gene ID:
Mouse(66104) transcription elongation factor A (SII)-like 6
Rat(679974) transcription elongation factor A (SII)-like 6
cow(783363) transcription elongation factor A (SII)-like 6
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025355 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025355 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025355 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001006938 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001006938 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001006938 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU092251 MISSION® esiRNA esiRNA targeting mouse Tceal6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006938 Rosetta Predictions human pricing
XM_001055134 Rosetta Predictions rat pricing
NM_025355 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305146 predicted 1016
2 SASI_Hs02_00305147 predicted 1025
3 SASI_Hs01_00220638 predicted 722
4 SASI_Hs02_00305148 predicted 998
5 SASI_Hs01_00220641 predicted 958
6 SASI_Hs02_00305149 predicted 999
7 SASI_Hs01_00220640 predicted 723
8 SASI_Hs02_00305150 predicted 1062
9 SASI_Hs02_00305151 predicted 1187
10 SASI_Hs02_00305152 predicted 1180
11 SASI_Hs01_00220637 predicted 709
12 SASI_Hs01_00220639 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055134 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278565 predicted 368
2 SASI_Rn02_00278566 predicted 600
3 SASI_Rn02_00278567 predicted 601
4 SASI_Rn02_00278568 predicted 666
5 SASI_Rn02_00278569 predicted 518
6 SASI_Rn02_00278570 predicted 269
7 SASI_Rn02_00278571 predicted 387
8 SASI_Rn02_00278572 predicted 372
9 SASI_Rn02_00278573 predicted 619
10 SASI_Rn02_00278574 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328032 predicted 540
2 SASI_Mm02_00328033 predicted 518
3 SASI_Mm02_00328034 predicted 516
4 SASI_Mm02_00328035 predicted 526
5 SASI_Mm01_00149540 predicted 502
6 SASI_Mm02_00328036 predicted 525
7 SASI_Mm02_00328037 predicted 448
8 SASI_Mm02_00328038 predicted 383
9 SASI_Mm02_00328039 predicted 444
10 SASI_Mm02_00328040 predicted 494
11 SASI_Mm01_00149532 predicted 888
12 SASI_Mm01_00149533 predicted 846
13 SASI_Mm01_00149534 predicted 859
14 SASI_Mm01_00149535 predicted 639
15 SASI_Mm01_00149536 predicted 753
16 SASI_Mm01_00149537 predicted 651
17 SASI_Mm01_00149538 predicted 653
18 SASI_Mm01_00149539 predicted 752
19 SASI_Mm01_00149541 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025355
VALIDATED
TCEAL6 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII)-like 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025355.2-367s1c1
Sequence:CCGGGACAAGAAAGCAAAGCCAGCACTCGAGTGCTGGCTTTGCTTTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025355.2-870s1c1
Sequence:CCGGGCCATCAATTCTGACCTCTCTCTCGAGAGAGAGGTCAGAATTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025355.2-672s1c1
Sequence:CCGGGATGAGAGAGTGCACAGATATCTCGAGATATCTGTGCACTCTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025355.2-355s1c1
Sequence:CCGGGAAGAGAAGCCAGACAAGAAACTCGAGTTTCTTGTCTGGCTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025355.2-313s1c1
Sequence:CCGGGAAGATGAAGTAGAGCCTGAACTCGAGTTCAGGCTCTACTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025355.3-547s21c1
Sequence:CCGGAGCGCCCTGCTGAAGATTATGCTCGAGCATAATCTTCAGCAGGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025355.3-692s21c1
Sequence:CCGGTAGGGCTCGGGAAGAGTTAAGCTCGAGCTTAACTCTTCCCGAGCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025355.3-855s21c1
Sequence:CCGGTAATGCCTTTGGCCATCAATTCTCGAGAATTGATGGCCAAAGGCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025355.3-929s21c1
Sequence:CCGGCTTGCCAGGCCTGTGCTTTAACTCGAGTTAAAGCACAGGCCTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025355.3-751s21c1
Sequence:CCGGGAGATGCACAGGATGCTTTAGCTCGAGCTAAAGCATCCTGTGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025355
VALIDATED
TCEAL6 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII)-like 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025355.2-367s1c1
Sequence:CCGGGACAAGAAAGCAAAGCCAGCACTCGAGTGCTGGCTTTGCTTTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025355.2-870s1c1
Sequence:CCGGGCCATCAATTCTGACCTCTCTCTCGAGAGAGAGGTCAGAATTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025355.2-672s1c1
Sequence:CCGGGATGAGAGAGTGCACAGATATCTCGAGATATCTGTGCACTCTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025355.2-355s1c1
Sequence:CCGGGAAGAGAAGCCAGACAAGAAACTCGAGTTTCTTGTCTGGCTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025355.2-313s1c1
Sequence:CCGGGAAGATGAAGTAGAGCCTGAACTCGAGTTCAGGCTCTACTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025355.3-547s21c1
Sequence:CCGGAGCGCCCTGCTGAAGATTATGCTCGAGCATAATCTTCAGCAGGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025355.3-692s21c1
Sequence:CCGGTAGGGCTCGGGAAGAGTTAAGCTCGAGCTTAACTCTTCCCGAGCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025355.3-855s21c1
Sequence:CCGGTAATGCCTTTGGCCATCAATTCTCGAGAATTGATGGCCAAAGGCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025355.3-929s21c1
Sequence:CCGGCTTGCCAGGCCTGTGCTTTAACTCGAGTTAAAGCACAGGCCTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025355.3-751s21c1
Sequence:CCGGGAGATGCACAGGATGCTTTAGCTCGAGCTAAAGCATCCTGTGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025355
VALIDATED
TCEAL6 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII)-like 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025355.2-367s1c1
Sequence:CCGGGACAAGAAAGCAAAGCCAGCACTCGAGTGCTGGCTTTGCTTTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025355.2-870s1c1
Sequence:CCGGGCCATCAATTCTGACCTCTCTCTCGAGAGAGAGGTCAGAATTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025355.2-672s1c1
Sequence:CCGGGATGAGAGAGTGCACAGATATCTCGAGATATCTGTGCACTCTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025355.2-355s1c1
Sequence:CCGGGAAGAGAAGCCAGACAAGAAACTCGAGTTTCTTGTCTGGCTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025355.2-313s1c1
Sequence:CCGGGAAGATGAAGTAGAGCCTGAACTCGAGTTCAGGCTCTACTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025355.3-547s21c1
Sequence:CCGGAGCGCCCTGCTGAAGATTATGCTCGAGCATAATCTTCAGCAGGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025355.3-692s21c1
Sequence:CCGGTAGGGCTCGGGAAGAGTTAAGCTCGAGCTTAACTCTTCCCGAGCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025355.3-855s21c1
Sequence:CCGGTAATGCCTTTGGCCATCAATTCTCGAGAATTGATGGCCAAAGGCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025355.3-929s21c1
Sequence:CCGGCTTGCCAGGCCTGTGCTTTAACTCGAGTTAAAGCACAGGCCTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025355.3-751s21c1
Sequence:CCGGGAGATGCACAGGATGCTTTAGCTCGAGCTAAAGCATCCTGTGCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001006938
TCEAL6 MISSION shRNA Bacterial Glycerol Stock
transcription elongation factor A (SII)-like 6
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006938.1-187s1c1
Sequence:CCGGGAGGGAAAGCCAGAAGATGAACTCGAGTTCATCTTCTGGCTTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163443    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006938.1-719s1c1
Sequence:CCGGGAGGCTTACACGATATCCCATCTCGAGATGGGATATCGTGTAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006938.1-223s1c1
Sequence:CCGGGAAGGAAAGTCAGACGAGGAACTCGAGTTCCTCGTCTGACTTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006938.1-196s1c1
Sequence:CCGGCCAGAAGATGAAGTAGAGCCTCTCGAGAGGCTCTACTTCATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006938.1-561s1c1
Sequence:CCGGGATGAGAGAATGTGGAGATGTCTCGAGACATCTCCACATTCTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158676    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006938.1-830s1c1
Sequence:CCGGGCTTTAACCTTAAGCTGATATCTCGAGATATCAGCTTAAGGTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159694    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006938.1-855s1c1
Sequence:CCGGGCTTTAGATGTCAATCTCGTTCTCGAGAACGAGATTGACATCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006938.1-317s1c1
Sequence:CCGGGACAACTGGAAGATAAGGGAACTCGAGTTCCCTTATCTTCCAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006938.1-556s1c1
Sequence:CCGGGAGATGATGAGAGAATGTGGACTCGAGTCCACATTCTCTCATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006938.1-264s1c1
Sequence:CCGGGAAGACAGAATGCGAGGGAAACTCGAGTTTCCCTCGCATTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163651    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006938.1-713s1c1
Sequence:CCGGGCCAAAGAGGCTTACACGATACTCGAGTATCGTGTAAGCCTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001006938
TCEAL6 MISSION shRNA shRNA Plasmid DNA
transcription elongation factor A (SII)-like 6
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006938.1-187s1c1
Sequence:CCGGGAGGGAAAGCCAGAAGATGAACTCGAGTTCATCTTCTGGCTTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163443    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006938.1-719s1c1
Sequence:CCGGGAGGCTTACACGATATCCCATCTCGAGATGGGATATCGTGTAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006938.1-223s1c1
Sequence:CCGGGAAGGAAAGTCAGACGAGGAACTCGAGTTCCTCGTCTGACTTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006938.1-196s1c1
Sequence:CCGGCCAGAAGATGAAGTAGAGCCTCTCGAGAGGCTCTACTTCATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006938.1-561s1c1
Sequence:CCGGGATGAGAGAATGTGGAGATGTCTCGAGACATCTCCACATTCTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158676    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006938.1-830s1c1
Sequence:CCGGGCTTTAACCTTAAGCTGATATCTCGAGATATCAGCTTAAGGTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159694    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006938.1-855s1c1
Sequence:CCGGGCTTTAGATGTCAATCTCGTTCTCGAGAACGAGATTGACATCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006938.1-317s1c1
Sequence:CCGGGACAACTGGAAGATAAGGGAACTCGAGTTCCCTTATCTTCCAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006938.1-556s1c1
Sequence:CCGGGAGATGATGAGAGAATGTGGACTCGAGTCCACATTCTCTCATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006938.1-264s1c1
Sequence:CCGGGAAGACAGAATGCGAGGGAAACTCGAGTTTCCCTCGCATTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163651    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006938.1-713s1c1
Sequence:CCGGGCCAAAGAGGCTTACACGATACTCGAGTATCGTGTAAGCCTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001006938
TCEAL6 MISSION shRNA Lentiviral Transduction Particles
transcription elongation factor A (SII)-like 6
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006938.1-187s1c1
Sequence:CCGGGAGGGAAAGCCAGAAGATGAACTCGAGTTCATCTTCTGGCTTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163443    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006938.1-719s1c1
Sequence:CCGGGAGGCTTACACGATATCCCATCTCGAGATGGGATATCGTGTAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006938.1-223s1c1
Sequence:CCGGGAAGGAAAGTCAGACGAGGAACTCGAGTTCCTCGTCTGACTTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006938.1-196s1c1
Sequence:CCGGCCAGAAGATGAAGTAGAGCCTCTCGAGAGGCTCTACTTCATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006938.1-561s1c1
Sequence:CCGGGATGAGAGAATGTGGAGATGTCTCGAGACATCTCCACATTCTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158676    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006938.1-830s1c1
Sequence:CCGGGCTTTAACCTTAAGCTGATATCTCGAGATATCAGCTTAAGGTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159694    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006938.1-855s1c1
Sequence:CCGGGCTTTAGATGTCAATCTCGTTCTCGAGAACGAGATTGACATCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006938.1-317s1c1
Sequence:CCGGGACAACTGGAAGATAAGGGAACTCGAGTTCCCTTATCTTCCAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006938.1-556s1c1
Sequence:CCGGGAGATGATGAGAGAATGTGGACTCGAGTCCACATTCTCTCATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006938.1-264s1c1
Sequence:CCGGGAAGACAGAATGCGAGGGAAACTCGAGTTTCCCTCGCATTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163651    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006938.1-713s1c1
Sequence:CCGGGCCAAAGAGGCTTACACGATACTCGAGTATCGTGTAAGCCTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks